NTNU NTNU, Norwegian University of Science and Technology www.ntnu.no/home A putative silencer element in the IL-5 gene recognized by Bcl6. A putative silencer element in the IL-5 gene recognized by Bcl6. J. Immunol. (0022-1767) 2002 imex curation Arima M., Toyama H., Ichii H., Kojima S., Okada S., Hatano M., Cheng G., Kubo M., Fukuda T., Tokuhisa T. tokuhisa@med.m.chiba-u.ac.jp 11-Jun-2014: Contacted by IntAct-Help. mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Arima M., Toyama H., Ichii H., Kojima S., Okada S., Hatano M., Cheng G., Kubo M., Fukuda T., Tokuhisa T. tokuhisa@med.m.chiba-u.ac.jp Accepted 2014-MAY-27 by ORCHARD J. Immunol. (0022-1767) 2002 imex curation A putative silencer element in the IL-5 gene recognized by Bcl6. A putative silencer element in the IL-5 gene recognized by Bcl6. J. Immunol. (0022-1767) 2002 imex curation Arima M., Toyama H., Ichii H., Kojima S., Okada S., Hatano M., Cheng G., Kubo M., Fukuda T., Tokuhisa T. tokuhisa@med.m.chiba-u.ac.jp 11-Jun-2014: Contacted by IntAct-Help. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa anti tag immunost anti tag immunostaining anti tag immunost Arima M., Toyama H., Ichii H., Kojima S., Okada S., Hatano M., Cheng G., Kubo M., Fukuda T., Tokuhisa T. Source of BCL6 inferred from previous work of the same author (PMID: 10533607) tokuhisa@med.m.chiba-u.ac.jp Accepted 2014-MAY-27 by ORCHARD J. Immunol. (0022-1767) 2002 imex curation A putative silencer element in the IL-5 gene recognized by Bcl6. A putative silencer element in the IL-5 gene recognized by Bcl6. J. Immunol. (0022-1767) 2002 imex curation Arima M., Toyama H., Ichii H., Kojima S., Okada S., Hatano M., Cheng G., Kubo M., Fukuda T., Tokuhisa T. tokuhisa@med.m.chiba-u.ac.jp 11-Jun-2014: Contacted by IntAct-Help. mouse-t-cell_cd4+ Mouse CD4 positive T-cell t-cell_cd4+ t cell cd4+ ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Arima M., Toyama H., Ichii H., Kojima S., Okada S., Hatano M., Cheng G., Kubo M., Fukuda T., Tokuhisa T. tokuhisa@med.m.chiba-u.ac.jp Accepted 2014-MAY-27 by ORCHARD J. Immunol. (0022-1767) 2002 imex curation A putative silencer element in the IL-5 gene recognized by Bcl6. A putative silencer element in the IL-5 gene recognized by Bcl6. J. Immunol. (0022-1767) 2002 imex curation Arima M., Toyama H., Ichii H., Kojima S., Okada S., Hatano M., Cheng G., Kubo M., Fukuda T., Tokuhisa T. tokuhisa@med.m.chiba-u.ac.jp 11-Jun-2014: Contacted by IntAct-Help. mouse-t-cell_th1 Mouse T helper cell Th1 t-cell_th1 T-helper cell 1 ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Arima M., Toyama H., Ichii H., Kojima S., Okada S., Hatano M., Cheng G., Kubo M., Fukuda T., Tokuhisa T. tokuhisa@med.m.chiba-u.ac.jp Accepted 2014-MAY-27 by ORCHARD J. Immunol. (0022-1767) 2002 imex curation il5_mouse_dna mIL5BS - Bcl6 binding site dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid mouse Mus musculus Mouse AACCTTACTACCCCATGCCAACAGAAAGCATAAAATGGTT il5_mouse_gene Interleukin 5 gene gene mouse Mus musculus Mouse bcl6_mouse B-cell lymphoma 6 protein homolog Bcl6 Bcl-6 protein protein mouse Mus musculus Mouse MASPADSCIQFTRHASDVLLNLNRLRSRDILTDVVIVVSREQFRAHKTVLMACSGLFYSIFTDQLKCNLSVINLDPEISPEGFCILLDFMYTSRLNLREGNIMAVMTTAMYLQMEHVVDTCRKFIKASEAEMAPALKPPREEFLNSRMLMPHDIMAYRGREVVENNMPLRNTPGCESRAFAPPLYSGLSTPPASYPMYSHLPLSTFLFSDEELRDAPRMPVANPFPKERALPCDSARQVPNEYSRPAMEVSPSLCHSNIYSPKEAVPEEARSDIHYSVPEGPKPAVPSARNAPYFPCDKASKEEERPSSEDEIALHFEPPNAPLNRKGLVSPQSPQKSDCQPNSPTESCSSKNACILQASGSPPAKSPTDPKACNWKKYKFIVLNSLNQNAKPEGSEQAELGRLSPRAYPAPPACQPPMEPANLDLQSPTKLSASGEDSTIPQASRLNNLVNRSLAGSPRSSSESHSPLYMHPPKCTSCGSQSPQHTEMCLHTAGPTFPEEMGETQSEYSDSSCENGTFFCNECDCRFSEEASLKRHTLQTHSDKPYKCDRCQASFRYKGNLASHKTVHTGEKPYRCNICGAQFNRPANLKTHTRIHSGEKPYKCETCGARFVQVAHLRAHVLIHTGEKPYPCEICGTRFRHLQTLKSHLRIHTGEKPYHCEKCNLHFRHKSQLRLHLRQKHGAITNTKVQYRVSAADLPPELPKAC DIP protein P41183 original sequence version: 102 2051DD808D32D5EC bcl6-il5 3 IL5 6 unspecified role unspecified role prey prey Bcl6 7 unspecified role unspecified role bait bait association association Fig 5A P41183 decreases expression at RNA level of ENSMUSG00000036117 (decreases activity of regulatory region as measured in reporter gene assay in K562-cells) - shown in Figure 6 Data processing comment on Bcl6 species: It is likely to be mouse Bcl6 even though this was not ascertained in the curated paper. Reason: in PMID: 9632807, the same authors report the cloning of mouse Bcl6 cDNA which was subsequently cloned into pcDNA3-expression vector, i.e. the same expression vector used here in reporter gene assay shown in Figure 6 P41183 decreases expression at RNA level of ENSMUSG00000036117 bcl6-il5-2 4 6 unspecified role unspecified role prey prey bcl6 7 unspecified role unspecified role bait bait association association Fig 5B bcl6-il5-3 1 6 unspecified role unspecified role prey prey 7 unspecified role unspecified role bait bait association association Fig 5B bcl6-il5-4 2 mut2 5 competitor competitor competitor prey prey a25c alias mut2 mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) mut1 5 competitor competitor competitor prey prey a24t alias mut1 mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) mil5bs bcl6 binding site 5 unspecified role unspecified role bait bait chemical synthesis Chemical synthesis (Chemical synthesis) emsa il5_mouse_dna oligonucleotide probe is labelled with DIG (digoxygenin) which is subsequently detected by anti-DIG immunoblot (alkaline phosphatase-linked anti-DIG) GST-Bcl6 7 unspecified role unspecified role prey prey gst-tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Data processing comment on Bcl6 species: It is likely to be mouse Bcl6 even though this was not ascertained in the curated paper. Reason: in PMID: 9632807, the same authors report the cloning of mouse Bcl6 cDNA which was subsequently used to generate a GST-Bcl6 fusion protein. It is highly likely that the same construct was used to generate GST-Bcl6 fusion in the present study direct interaction direct interaction Fig 3B