I2D I2D Identification and characterization of human MUS81-MMS4 structure-specific endonuclease. Identification and characterization of human MUS81-MMS4 structure-specific endonuclease. J. Biol. Chem. (0021-9258) 2003 imex curation Ogrunc M., Sancar A. aziz_sancar@med.unc.edu 06-April-2011: Contacted by JYOTI. orchard Only protein-protein interactions Curated by: I2D - Interologous Interaction Database human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. enzymatic study enzymatic study autoradiography autoradiography Ogrunc M., Sancar A. aziz_sancar@med.unc.edu Accepted 2010-Not a month!-7 by ORCHARD. 06-April-2011: Contacted by JYOTI. J. Biol. Chem. (0021-9258) 2003 orchard Only protein-protein interactions imex curation Curated by: I2D - Interologous Interaction Database Identification and characterization of human MUS81-MMS4 structure-specific endonuclease. Identification and characterization of human MUS81-MMS4 structure-specific endonuclease. J. Biol. Chem. (0021-9258) 2003 imex curation Ogrunc M., Sancar A. aziz_sancar@med.unc.edu 06-April-2011: Contacted by JYOTI. orchard Only protein-protein interactions Curated by: I2D - Interologous Interaction Database human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti tag coip anti tag coimmunoprecipitation anti tag coip anti tag western anti tag western blot anti tag western Ogrunc M., Sancar A. aziz_sancar@med.unc.edu Accepted 2010-Not a month!-7 by ORCHARD. 06-April-2011: Contacted by JYOTI. J. Biol. Chem. (0021-9258) 2003 orchard Only protein-protein interactions imex curation Curated by: I2D - Interologous Interaction Database y-structure-oligo-1 Y structure for endonuclease assay: oligo 1 ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) GACGCTGCCGAATTCTGGCTTGCTAGGACATCTTTGCCCACGTTGACCCG 477F5987EDE8FA4D mus81_human Crossover junction endonuclease MUS81 MUS81 protein protein human Homo sapiens Human MAAPVRLGRKRPLPACPNPLFVRWLTEWRDEATRSRRRTRFVFQKALRSLRRYPLPLRSGKEAKILQHFGDGLCRMLDERLQRHRTSGGDHAPDSPSGENSPAPQGRLAEVQDSSMPVPAQPKAGGSGSYWPARHSGARVILLVLYREHLNPNGHHFLTKEELLQRCAQKSPRVAPGSARPWPALRSLLHRNLVLRTHQPARYSLTPEGLELAQKLAESEGLSLLNVGIGPKEPPGEETAVPGAASAELASEAGVQQQPLELRPGEYRVLLCVDIGETRGGGHRPELLRELQRLHVTHTVRKLHVGDFVWVAQETNPRDPANPGELVLDHIVERKRLDDLCSSIIDGRFREQKFRLKRCGLERRVYLVEEHGSVHNLSLPESTLLQAVTNTQVIDGFFVKRTADIKESAAYLALLTRGLQRLYQGHTLRSRPWGTPGNPESGAMTSPNPLCSLLTFSDFNAGAIKNKAQSVREVFARQLMQVRGVSGEKAAALVDRYSTPASLLAAYDACATPKEQETLLSTIKCGRLQRNLGPALSRTLSQLYCSYGPLT DIP protein Q96NY9 original sequence version: 81 D0F331CC2269D847 y-structure-oligo-2 Y structure for endonuclease assay: oligo 2 ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) GCGATAGTCTCTAGACAGCATGTCCTAGCAAGCCAGAATTCGGCAGCGTC 1C3ACE5ECD4E351D eme1_human Crossover junction endonuclease EME1 EME1 MMS4 MMS4 homolog protein protein human Homo sapiens Human MALKKSSPSLDSGDSDSEELPTFAFLKKEPSSTKRRQPEREEKIVVVDISDCEASCPPAPELFSPPVPEIAETVTQTQPVRLLSSESEDEEEFIPLAQRLTCKFLTHKQLSPEDSSSPVKSVLDHQNNEGASCDWKKPFPKIPEVPLHDTPERSAADNKDLILDPCCQLPAYLSTCPGQSSSLAVTKTNSDILPPQKKTKPSQKVQGRGSHGCRQQRQARQKESTLRRQERKNAALVTRMKAQRPEECLKHIIVVLDPVLLQMEGGGQLLGALQTMECRCVIEAQAVPCSVTWRRRAGPSEDREDWVEEPTVLVLLRAEAFVSMIDNGKQGSLDSTMKGKETLQGFVTDITAKTAGKALSLVIVDQEKCFSAQNPPRRGKQGANKQTKKQQQRQPEASIGSMVSRVDAEEALVDLQLHTEAQAQIVQSWKELADFTCAFTKAVAEAPFKKLRDETTFSFCLESDWAGGVKVDLAGRGLALVWRRQIQQLNRVSLEMASAVVNAYPSPQLLVQAYQQCFSDKERQNLLADIQVRRGEGVTSTSRRIGPELSRRIYLQMTTLQPHLSLDSAD DIP protein Q96AY2 original sequence version: 73 BA08F5655761AF85 hmus81-hmms4 2 4 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 2, 3a hmus81-hmms4-1 2 4 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role bait bait region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 3a hmus81-hmms4-2 1 6 enzyme enzyme unspecified role unspecified role region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 enzyme enzyme unspecified role unspecified role region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 enzyme target enzyme target substrate substrate unspecified role unspecified role 3 enzyme target enzyme target substrate substrate unspecified role unspecified role physical association physical association Fig. 3b