IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. J. Immunol. (0022-1767) 2007 imex curation Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. krensky@stanford.edu 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA Only protein-protein interactions in vitro In vitro protein kinase assay protein kinase assay predetermined predetermined participant predetermined Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Accepted 2007-JUL-12 by JYOTI. 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. J. Immunol. (0022-1767) 2007 imex curation Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. krensky@stanford.edu 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA Only protein-protein interactions chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Accepted 2007-JUL-12 by JYOTI. 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. J. Immunol. (0022-1767) 2007 imex curation Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. krensky@stanford.edu 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Accepted 2007-JUL-12 by JYOTI. 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. J. Immunol. (0022-1767) 2007 imex curation Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. krensky@stanford.edu 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA Only protein-protein interactions chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 imaging technique imaging technique microscopy immunostaining immunostaining Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Accepted 2007-JUL-12 by JYOTI. 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. J. Immunol. (0022-1767) 2007 imex curation Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. krensky@stanford.edu 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA Only protein-protein interactions yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid full dna sequence full identification by DNA sequencing full dna sequence Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. krensky@stanford.edu Accepted 2007-JUL-12 by JYOTI. Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. J. Immunol. (0022-1767) 2007 imex curation Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. krensky@stanford.edu 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA Only protein-protein interactions chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Accepted 2007-JUL-12 by JYOTI. 29-OCT-2007: Contacted by JYOTI. Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation a_b_ccl5 promoter A/B site of the CCL5 promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human AATTCGCTATTTTGGAAACTCCCCTTAGGGGATGCCCCTCAACTGCG 32AD2C06CC1132CA klf13_human Krueppel-like factor 13 KLF13 BTEB3 NSLP1 Transcription factor BTEB3 Basic transcription element-binding protein 3 RANTES factor of late activated T-lymphocytes 1 Transcription factor NSLP1 Novel Sp1-like zinc finger transcription factor 1 protein protein human Homo sapiens Human MAAAAYVDHFAAECLVSMSSRAVVHGPREGPESRPEGAAVAATPTLPRVEERRDGKDSASLFVVARILADLNQQAPAPAPAERREGAAARKARTPCRLPPPAPEPTSPGAEGAAAAPPSPAWSEPEPEAGLEPEREPGPAGSGEPGLRQRVRRGRSRADLESPQRKHKCHYAGCEKVYGKSSHLKAHLRTHTGERPFACSWQDCNKKFARSDELARHYRTHTGEKKFSCPICEKRFMRSDHLTKHARRHANFHPGMLQRRGGGSRTGSLSDYSRSDASSPTISPASSP DD2765EE00E9C049 nlk_human Serine/threonine-protein kinase NLK NLK LAK1 Nemo-like kinase Protein LAK1 protein protein human Homo sapiens Human MSLCGARANAKMMAAYNGGTSAAAAGHHHHHHHHLPHLPPPHLHHHHHPQHHLHPGSAAAVHPVQQHTSSAAAAAAAAAAAAAMLNPGQQQPYFPSPAPGQAPGPAAAAPAQVQAAAAATVKAHHHQHSHHPQQQLDIEPDRPIGYGAFGVVWSVTDPRDGKRVALKKMPNVFQNLVSCKRVFRELKMLCFFKHDNVLSALDILQPPHIDYFEEIYVVTELMQSDLHKIIVSPQPLSSDHVKVFLYQILRGLKYLHSAGILHRDIKPGNLLVNSNCVLKICDFGLARVEELDESRHMTQEVVTQYYRAPEILMGSRHYSNAIDIWSVGCIFAELLGRRILFQAQSPIQQLDLITDLLGTPSLEAMRTACEGAKAHILRGPHKQPSLPVLYTLSSQATHEAVHLLCRMLVFDPSKRISAKDALAHPYLDEGRLRYHTCMCKCCFSTSTGRVYTSDFEPVTNPKFDDTFEKNLSSVRQVKEIIHQFILEQQKGNRVPLCINPQSAAFKSFISSTVAQPSEMPPSPLVWE CE6AEBA7D8133989 prp4b_human Serine/threonine-protein kinase PRP4 homolog PRPF4B KIAA0536 PRP4 PRP4H PRP4K PRP4 pre-mRNA-processing factor 4 homolog PRP4 kinase protein protein human Homo sapiens Human MAAAETQSLREQPEMEDANSEKSINEENGEVSEDQSQNKHSRHKKKKHKHRSKHKKHKHSSEEDKDKKHKHKHKHKKHKRKEIIDASDKEGMSPAKRTKLDDLALLEDLEKQRALIKAELDNELMEGKVQSGMGLILQGYESGSEEEGEIHEKARNGNRSSTRSSSTKGKLELVDNKITTKKRSKSRSKERTRHRSDKKKSKGGIEIVKEKTTRSKSKERKKSKSPSKRSKSQDQARKSKSPTLRRRSQEKIGKARSPTDDKVKIEDKSKSKDRKKSPIINESRSRDRGKKSRSPVDLRGKSKDRRSRSKERKSKRSETDKEKKPIKSPSKDASSGKENRSPSRRPGRSPKRRSLSPKPRDKSRRSRSPLLNDRRSKQSKSPSRTLSPGRRAKSRSLERKRREPERRRLSSPRTRPRDDILSRRERSKDASPINRWSPTRRRSRSPIRRRSRSPLRRSRSPRRRSRSPRRRDRGRRSRSRLRRRSRSRGGRRRRSRSKVKEDKFKGSLSEGMKVEQESSSDDNLEDFDVEEEDEEALIEQRRIQRQAIVQKYKYLAEDSNMSVPSEPSSPQSSTRTRSPSPDDILERVAADVKEYERENVDTFEASVKAKHNLMTVEQNNGSSQKKLLAPDMFTESDDMFAAYFDSARLRAAGIGKDFKENPNLRDNWTDAEGYYRVNIGEVLDKRYNVYGYTGQGVFSNVVRARDNARANQEVAVKIIRNNELMQKTGLKELEFLKKLNDADPDDKFHCLRLFRHFYHKQHLCLVFEPLSMNLREVLKKYGKDVGLHIKAVRSYSQQLFLALKLLKRCNILHADIKPDNILVNESKTILKLCDFGSASHVADNDITPYLVSRFYRAPEIIIGKSYDYGIDMWSVGCTLYELYTGKILFPGKTNNHMLKLAMDLKGKMPNKMIRKGVFKDQHFDQNLNFMYIEVDKVTEREKVTVMSTINPTKDLLADLIGCQRLPEDQRKKVHQLKDLLDQILMLDPAKRISINQALQHAFIQEKI EC8C1538A61EDA78 klf13-prpf4b-1 5 8 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey physical association physical association Using yeast two-hybrid screening of a human thymus cDNA library, PRP4, a serine/threonine protein kinase, was identified as a KLF13-binding protein. klf13-prpf4b-2 6 10 unspecified role unspecified role bait bait region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role prey prey physical association physical association Only HA-PRP4-transfected COS7 lysates immunoprecipitated with an anti-HA Ab against tagged PRP4 pulled down KLF13 (Fig. 1A), 1A klf13-prpf4b-3 2 8 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association the reciprocal experiment using a KLF13 Ab pulled down PRP4 (Fig. 1B) 1B prpf4b-1 1 10 putative self putative self putative self putative self chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 phosphorylation phosphorylation reaction phosphorylation true Under these conditions, immunoprecipitated PRP4 phosphorylated both itself and KLF13 (Fig. 3A, lane 4). Fig. 3A prpf4b-klf13-2 1 10 enzyme enzyme unspecified role unspecified role chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 8 enzyme target enzyme target substrate substrate unspecified role unspecified role region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) phosphorylation phosphorylation reaction phosphorylation Under these conditions, immunoprecipitated PRP4 phosphorylated both itself and KLF13 (Fig. 3A, lane 4). Fig. 3A nlk-1 1 9 putative self putative self putative self putative self chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 phosphorylation phosphorylation reaction phosphorylation true In contrast, immunoprecipitated NLK phosphorylated itself, but not KLF13 (Fig. 3A Fig. 3A klf13-ccl5_dna-1 3 8 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecobb Escherichia coli (strain B / BL21) 7 unspecified role unspecified role neutral component neutral component direct interaction direct interaction To test whether the phosphorylation of KLF13 by PRP4 affects its interaction with the CCL5 promoter, EMSA was performed using a {gamma}-32P-end-labeled oligonucleotide derived from the A/B region of the CCL5 promoter. Fig. 3B Nucleic acid was radio-labelled. Interaction inhibited by phosphorylation of KLF13 by PRPF4 and super-shifted by addition of anti-KLF13 antibodies. prpf4b-klf13-3 4 8 unspecified role unspecified role neutral component neutral component region gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role neutral component neutral component region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined colocalization colocalization In contrast, overexpressed KLF13 resides exclusively in the nuclei of the other cells in the same field that is coexpressing both KLF13 and PRP4, supporting the role of PRP4 in KLF13 nuclear translocation. Fig. 5