IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu 02-MAR-2006: Contacted by JYOTI. orchard in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu Accepted 2007-JAN-23 by ORCHARD. 02-MAR-2006: Contacted by JYOTI. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 orchard Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu 02-MAR-2006: Contacted by JYOTI. orchard in vitro In vitro elisa enzyme linked immunosorbent assay ELISA ELISA elisa antibody detection identification by antibody antibody detection Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu Accepted 2007-JAN-23 by ORCHARD. 02-MAR-2006: Contacted by JYOTI. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 orchard Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu 02-MAR-2006: Contacted by JYOTI. orchard in vitro In vitro fret fluorescent resonance energy transfer FRET RET FRET analysis FRET RET FRET analysis fret predetermined predetermined participant predetermined Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu Accepted 2007-JAN-23 by ORCHARD. 02-MAR-2006: Contacted by JYOTI. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 orchard Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu 02-MAR-2006: Contacted by JYOTI. orchard in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu Accepted 2007-JAN-23 by ORCHARD. 02-MAR-2006: Contacted by JYOTI. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 orchard myc_human Myc proto-oncogene protein BHLHE39 Transcription factor p64 MYC Proto-oncogene c-Myc Class E basic helix-loop-helix protein 39 protein protein human Homo sapiens Human MPLNVSFTNRNYDLDYDSVQPYFYCDEEENFYQQQQQSELQPPAPSEDIWKKFELLPTPPLSPSRRSGLCSPSYVAVTPFSLRGDNDGGGGSFSTADQLEMVTELLGGDMVNQSFICDPDDETFIKNIIIQDCMWSGFSAAAKLVSEKLASYQAARKDSGSPNPARGHSVCSTSSLYLQDLSAAASECIDPSVVFPYPLNDSSSPKSCASQDSSAFSPSSDSLLSSTESSPQGSPEPLVLHEETPPTTSSDSEEEQEDEEEIDVVSVEKRQAPGKRSESGSPSAGGHSKPPHSPLVLKRCHVSTHQHNYAAPPSTRKDYPAAKRVKLDSVRVLRQISNNRKCTSPRSSDTEENVKRRTHNVLERQRRNELKRSFFALRDQIPELENNEKAPKVVILKKATAYILSVQAEEQKLISEEDLLRKRREQLKHKLEQLRNSCA DIP protein P01106 original sequence version: 195 DIP protein P01106 original sequence version: 196 DIP protein P01106 original sequence version: 148 DIP protein P01106-1 original sequence version: 161 DIP protein P01106 original sequence version: 182 DIP protein P01106 original sequence version: 197 DIP protein P01106-1 original sequence version: 208 DIP protein P01106 original sequence version: 121 DIP protein P01106-1 original sequence version: 144 DIP protein P01106 original sequence version: 144 ED5C028029A4C5D1 max_rat Protein max Max Myc-associated factor X protein protein rat Rattus norvegicus (Rat) Rat MSDNDDIEVESDEEQPRFQSAADKRAHHNALERKRRDHIKDSFHSLRDSVPSLQGEKASRAQILDKATEYIQYMRRKNHTHQQDIDDLKRQNALLEQQVRALEKARSSAQLQTNYPSSDNSLYTNAKGGTISAFDGGSDSSSESEPEEPQNRKKLRMEAS 86CB1A137727A57A myc_max_consensus-1 Consensus binding site of c-Myc/Max dimers AGTTGACCACGTGGTCTGGG dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) AGTTGACCACGTGGTCTGGG 931104D5AE0C772A myc-max-1 3 6 unspecified role unspecified role fluorescence accept fluorescence acceptor fluorescence accept c-terminal yfp tag yellow fluorescent protein tag YFP yellow fluorescent protein yellow fluorescent protein YFP yfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) 5 unspecified role unspecified role fluorescence donor fluorescence donor c-terminal cfp tag cyan fluorescent protein tag CFP cyan fluorescent protein cyan fluorescent protein CFP cfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) direct interaction direct interaction the bHLHZip domains of Myc and of Max were fused to the N termini of CFP (MycCFP) and YFP (MaxYFP), respectively. The fusions were expressed in E. coli, purified, and allowed to dimerize, followed by excitation of CFP at wave 433 nm. Dimerization generated a FRET spectrum characterized by a strong emission signal of YFP at 525 nm and a weaker emission signal of CFP at 475 nm. Table 1 This interaction was inhibited by four compounds from a peptidomimetic library (IIA4B20, IIA6B17, IIA4B11 and IA4B11). max-myc-1 2 6 unspecified role unspecified role bait bait region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) 5 unspecified role unspecified role prey prey c-terminal gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) 17 20 direct interaction direct interaction Table 1 This interaction was inhibited by three compounds from a peptidomimetic library (IIA4B20, IIA6B17 and IIA4B11). max-myc-2 1 5 unspecified role unspecified role neutral component neutral component region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain c-terminal gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecobb Escherichia coli (strain B / BL21) 7 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role neutral component neutral component region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) association association 2 This interaction was inhibited by three compounds from a peptidomimetic library (IIA6B17,IIA4B11 and IA4B1). Under the assay conditions, Myc/Max dimers, but not Max/Max homodimers efficiently bound DNA, resulting in a single retarded band in electrophoresis max-myc-3 4 6 unspecified role unspecified role neutral component neutral component region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) 7 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role neutral component neutral component c-terminal gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) association association 2 A This interaction was inhibited by three compounds from a peptidomimetic library (IIA6B17,IIA4B11 and IA4B1). anti-GFP antibody supershifts the dimer/DNA complex