IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Nucleocapsid protein of SARS-CoV activates the expression of cyclooxygenase-2 by binding directly to regulatory elements for nuclear factor-kappa B and CCAAT/enhancer binding protein. Nucleocapsid protein of SARS-CoV activates the expression of cyclooxygenase-2 by binding directly to regulatory elements for nuclear factor-kappa B and CCAAT/enhancer binding protein. The international journal of biochemistry & cell biology 2005 imex curation Yan X., Hao Q., Mu Y., Timani KA., Ye L., Zhu Y., Wu J. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus wu9988@vip.sina.com 28-Sep-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Yan X., Hao Q., Mu Y., Timani KA., Ye L., Zhu Y., Wu J. Virus - Publications including interactions involving viral proteins wu9988@vip.sina.com Accepted 2020-SEP-02 AT 10:35 BST AT 10:35 BST by MGT The international journal of biochemistry & cell biology 2005 Only protein-protein interactions imex curation imex curation Nucleocapsid protein of SARS-CoV activates the expression of cyclooxygenase-2 by binding directly to regulatory elements for nuclear factor-kappa B and CCAAT/enhancer binding protein. Nucleocapsid protein of SARS-CoV activates the expression of cyclooxygenase-2 by binding directly to regulatory elements for nuclear factor-kappa B and CCAAT/enhancer binding protein. The international journal of biochemistry & cell biology 2005 imex curation Yan X., Hao Q., Mu Y., Timani KA., Ye L., Zhu Y., Wu J. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus wu9988@vip.sina.com 28-Sep-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Yan X., Hao Q., Mu Y., Timani KA., Ye L., Zhu Y., Wu J. Virus - Publications including interactions involving viral proteins wu9988@vip.sina.com Accepted 2020-SEP-02 AT 10:35 BST AT 10:35 BST by MGT The international journal of biochemistry & cell biology 2005 Only protein-protein interactions imex curation imex curation ncap_sars Nucleoprotein N 9a Nucleocapsid protein protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus MSDNGPQSNQRSAPRITFGGPTDSTDNNQNGGRNGARPKQRRPQGLPNNTASWFTALTQHGKEELRFPRGQGVPINTNSGPDDQIGYYRRATRRVRGGDGKMKELSPRWYFYYLGTGPEASLPYGANKEGIVWVATEGALNTPKDHIGTRNPNNNAATVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRGNSRNSTPGSSRGNSPARMASGGGETALALLLLDRLNQLESKVSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKQYNVTQAFGRRGPEQTQGNFGDQDLIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYHGAIKLDDKDPQFKDNVILLNKHIDAYKTFPPTEPKKDKKKKTDEAQPLPQRQKKQPTVTLLPAADMDDFSRQLQNSMSGASADSTQA mint Major structural component of virions that associates with genomic RNA to form a long, flexible, helical nucleocapsid 43FC8750F1253034 pgh2_human_gene PTGS2/COX2/Prostaglandin G/H synthase 2 gene gene human Homo sapiens Human pgh2_human_gene-n-4 2 3 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. 4 unspecified role unspecified role bait bait C/EBP element sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5'TTACGCAA3' Chr 1:186680549-186680556 (reverse strand) region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 3a (lane 6) pgh2_human_gene-n-5 2 3 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. 4 unspecified role unspecified role bait bait NF-kB2 element sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined AGAGTGGGGACTACCCCCTCTGCTC Chr 1: 186680629-186680653 (reverse strand) region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 3b (lane 6) pgh2_human_gene-n-6 1 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range 4 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level CP1 region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Chr:1 186680904-186680927 (reverse strand) physical association physical association Fig. 4a n-pgh2_human_gene-2 1 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range 4 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level NF-kB-CP1 region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Chr:1 186680649-186680668 (reverse strand) physical association physical association Fig. 4b n-pgh2_human_gene-3 1 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range 4 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level C/EBP enhancer region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Chr:1 186680559 to 186680580 (reverse strand) physical association physical association Fig. 4c