HPIDb Host Pathogen Interaction database http://www.agbase.msstate.edu/hpi/main.html Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. J. Virol. (0022-538X) 2001 imex curation Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg 13-Jan-2014: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro enzymatic study enzymatic study autoradiography autoradiography Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg Accepted 2013-DEC-13 by ORCHARD J. Virol. (0022-538X) 2001 imex curation Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. J. Virol. (0022-538X) 2001 imex curation Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg 13-Jan-2014: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column western blot western blot Immuno blot Immuno blot Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg Accepted 2013-DEC-13 by ORCHARD J. Virol. (0022-538X) 2001 imex curation Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. J. Virol. (0022-538X) 2001 imex curation Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg 13-Jan-2014: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg Accepted 2013-DEC-13 by ORCHARD J. Virol. (0022-538X) 2001 imex curation Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. J. Virol. (0022-538X) 2001 imex curation Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg 13-Jan-2014: Contacted by IntAct-Help. Only protein-protein interactions imex curation chlae-cv-1 Monkey African Green kidney fibroblast Grivet cv-1 Monkey African Green kidney fibroblast anti tag coip anti tag coimmunoprecipitation anti tag coip anti tag western anti tag western blot anti tag western Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg Accepted 2013-DEC-13 by ORCHARD J. Virol. (0022-538X) 2001 imex curation p27958-pro_0000037573 Serine protease/helicase NS3 protein protein HCV77 Hepatitis C virus genotype 1a (isolate H77) APITAYAQQTRGLLGCIITSLTGRDKNQVEGEVQIVSTATQTFLATCINGVCWTVYHGAGTRTIASPKGPVIQTYTNVDQDLVGWPAPQGSRSLTPCTCGSSDLYLVTRHADVIPVRRRGDSRGSLLSPRPISYLKGSSGGPLLCPTGHAVGLFRAAVCTRGVAKAVDFIPVENLETTMRSPVFTDNSSPPAVPQSFQVAHLHAPTGSGKSTKVPAAYAAKGYKVLVLNPSVAATLGFGAYMSKAHGVDPNIRTGVRTITTGSPITYSTYGKFLADAGCSGGAYDIIICDECHSTDATSISGIGTVLDQAETAGARLVVLATATPPGSVTVSHPNIEEVALSTTGEIPFYGKAIPLEVIKGGRHLIFCHSKKKCDELAAKLVALGINAVAYYRGLDVSVIPTSGDVVVVSTDALMTGFTGDFDSVIDCNTCVTQTVDFSLDPTFTIETTTLPQDAVSRTQRRGRTGRGKPGIYRFVAPGERPSGMFDSSVLCECYDAGCAWYELTPAETTVRLRAYMNTPGLPVCQDHLGFWEGVFTGLTHIDAHFLSQTKQSGENFPYLVAYQATVCARAQAPPPSWDQMRKCLIRLKPTLHGPTPLLYRLGAVQNEVTLTHPITKYIMTCMSADLEVVT 1027 1657 5601AD5882D04C8F olg54_olg55 Double-stranded oligodeoxynucleotide olg54_olg55 ds dna double stranded deoxyribonucleic acid ds DNA ds dna chemical synthesis Chemical synthesis (Chemical synthesis) GTCAGTTGAGTGGCAGGCGGCACACATTATAGTGTCGTAGGCTTC olg39 39-mer oligonucleotide nucleic acid nucleic acid hcvh Hepatitis C virus genotype 1a (isolate H) (HCV) ATAATGTGTGCTGCCTGCCACTCAACTGACTCAACT p27958_pro-p27958_pro-4 3 NS3 5 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain P27958-PRO_0000037573:p.Ile288Thr mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain I T Wed May 02 17:48:50 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ile288thr' Tue Jun 30 18:24:53 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ile288Thr' P27958-PRO_0000037573:p.Thr266Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain T A Wed May 02 14:35:57 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'thr266ala' Tue Jun 30 17:01:55 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Thr266Ala' P27958-PRO_0000037573:p.Ser268Pro mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain S P Wed May 02 17:22:39 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser268pro' Tue Jun 30 19:01:20 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser268Pro' P27958-PRO_0000037573:p.Tyr267Ser mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain Y S Wed May 02 15:17:54 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'tyr267ser' Tue Jun 30 16:38:22 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr267Ser' P27958-PRO_0000037573:p.Thr269Ala mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain T A Wed May 02 15:53:25 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'thr269ala' Tue Jun 30 15:49:14 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Thr269Ala' NS3 5 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 10 17 physical association physical association Fig. 1A, 2A and 5 ns3 dimer-1 4 NS3 5 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain flag tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined NS3 5 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 23 20 physical association physical association Fig. 1B and 2B p27958_pro-p27958_pro-1 2 NS3 5 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain P27958-PRO_0000037573:p.Ile288Thr mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain I T Wed May 02 16:35:53 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ile288thr' Tue Jun 30 18:54:50 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ile288Thr' P27958-PRO_0000037573:p.Thr266Ala mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain T A Wed May 02 14:39:39 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'thr266ala' Tue Jun 30 19:58:31 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Thr266Ala' P27958-PRO_0000037573:p.Tyr267Ser mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain Y S Wed May 02 19:27:33 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'tyr267ser' Tue Jun 30 19:29:08 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr267Ser' 7 stimulator stimulator unspecified role unspecified role physical association physical association Fig. 3 and 4B When 39-mer oligonucleotide (OLG39: 39ATAATGTGTGCTGCCTGCCACTCAACTGACTCAACT59) was added, NS3 formed a dimer. ns3-olg54_olg54-1 1 NS3 5 enzyme enzyme neutral component neutral component P27958-PRO_0000037573:p.Tyr267Ser mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain Y S Wed May 02 14:45:04 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'tyr267ser' Tue Jun 30 18:38:57 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr267Ser' P27958-PRO_0000037573:p.Ile288Thr mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain I T Wed May 02 15:46:53 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ile288thr' Tue Jun 30 17:32:52 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ile288Thr' region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain P27958-PRO_0000037573:p.Thr266Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain T A Wed May 02 17:08:19 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'thr266ala' Tue Jun 30 19:04:17 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Thr266Ala' 6 enzyme target enzyme target substrate substrate neutral component neutral component enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig. 6 double-stranded oligodeoxynucleotide used as a substrate