IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. Biochim. Biophys. Acta (0006-3002) 2013 imex curation Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis RXR proteins were also detected as participants of the interactions in this experiment; however, as the specificity of the antibody for a specific RXR isoform is not indicated, the exact identity of the RXR participant could not be established and hence it was not captured here. The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu Accepted 2014-DEC-15 by MGT Biochim. Biophys. Acta (0006-3002) 2013 Only protein-protein interactions imex curation Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. Biochim. Biophys. Acta (0006-3002) 2013 imex curation Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis RXR proteins were also detected as participants binding to the CAR-site DNA probe in this experiment; however, as the specificity of the antibody for a specific RXR isoform is not indicated, the exact identity of the RXR participant could not be established and hence it was not captured here. The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu Accepted 2014-DEC-15 by MGT Biochim. Biophys. Acta (0006-3002) 2013 Only protein-protein interactions imex curation Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. Biochim. Biophys. Acta (0006-3002) 2013 imex curation Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu Accepted 2014-DEC-15 by MGT Biochim. Biophys. Acta (0006-3002) 2013 Only protein-protein interactions imex curation Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. Biochim. Biophys. Acta (0006-3002) 2013 imex curation Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro pull down pull down ms participant Identification by mass spectrometry ms participant Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu Accepted 2014-DEC-15 by MGT Biochim. Biophys. Acta (0006-3002) 2013 Only protein-protein interactions imex curation nr1i3_human Nuclear receptor subfamily 1 group I member 3 NR1I3 CAR Constitutive androstane receptor Constitutive activator of retinoid response Orphan nuclear receptor MB67 protein protein human Homo sapiens Human MASREDELRNCVVCGDQATGYHFNALTCEGCKGFFRRTVSKSIGPTCPFAGSCEVSKTQRRHCPACRLQKCLDAGMRKDMILSAEALALRRAKQAQRRAQQTPVQLSKEQEELIRTLLGAHTRHMGTMFEQFVQFRPPAHLFIHHQPLPTLAPVLPLVTHFADINTFMVLQVIKFTKDLPVFRSLPIEDQISLLKGAAVEICHIVLNTTFCLQTQNFLCGPLRYTIEDGARVSPTVGFQVEFLELLFHFHGTLRKLQLQEPEYVLLAAMALFSPDRPGVTQRDEIDQLQEEMALTLQSYIKGQQRRPRDRFLYAKLLGLLAELRSINEAYGYQIQHIQGLSAMMPLLQEICS 73B060FE4950D519 hyep_human_hnf4a-site_dna-probe Human HYEP gene promoter HNF4a binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGTTTGCTGTGCAGAGTCCAGGGGA rxra_human Retinoic acid receptor RXR-alpha RXRA NR2B1 Retinoid X receptor alpha Nuclear receptor subfamily 2 group B member 1 protein protein human Homo sapiens Human MDTKHFLPLDFSTQVNSSLTSPTGRGSMAAPSLHPSLGPGIGSPGQLHSPISTLSSPINGMGPPFSVISSPMGPHSMSVPTTPTLGFSTGSPQLSSPMNPVSSSEDIKPPLGLNGVLKVPAHPSGNMASFTKHICAICGDRSSGKHYGVYSCEGCKGFFKRTVRKDLTYTCRDNKDCLIDKRQRNRCQYCRYQKCLAMGMKREAVQEERQRGKDRNENEVESTSSANEDMPVERILEAELAVEPKTETYVEANMGLNPSSPNDPVTNICQAADKQLFTLVEWAKRIPHFSELPLDDQVILLRAGWNELLIASFSHRSIAVKDGILLATGLHVHRNSAHSAGVGAIFDRVLTELVSKMRDMQMDKTELGCLRAIVLFNPDSKGLSNPAEVEALREKVYASLEAYCKHKYPEQPGRFAKLLLRLPALRSIGLKCLEHLFFFKLIGDTPIDTFLMEMLEAPHQMT DIP protein P19793 original sequence version: 177 DIP protein P19793 original sequence version: 107 DIP protein P19793 original sequence version: 153 DIP protein P19793 original sequence version: 131 DIP protein P19793 original sequence version: 136 DIP protein P19793 original sequence version: 169 DIP protein P19793 original sequence version: 161 DIP protein P19793 original sequence version: 139 7F952B580AD84C42 hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI 5F1309B89D95DCAF hyep_human_car-site_dna-probe Human HYEP gene promoter CAR binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TGTCTCAGGTCAGCGTGGTTCAGTTTG hyep_human_car+hnf4a-site_dna-probe Human HYEP gene promoter CAR and HNF4A binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TCTCAGGTCAGCGTGGTTCAGTTTGCTGTGCAGAGTCCAGGGGA sfpq_human Splicing factor, proline- and glutamine-rich SFPQ PSF Polypyrimidine tract-binding protein-associated-splicing factor DNA-binding p52/p100 complex, 100 kDa subunit 100 kDa DNA-pairing protein protein protein human Homo sapiens Human MSRDRFRSRGGGGGGFHRRGGGGGRGGLHDFRSPPPGMGLNQNRGPMGPGPGQSGPKPPIPPPPPHQQQQQPPPQQPPPQQPPPHQPPPHPQPHQQQQPPPPPQDSSKPVVAQGPGPAPGVGSAPPASSSAPPATPPTSGAPPGSGPGPTPTPPPAVTSAPPGAPPPTPPSSGVPTTPPQAGGPPPPPAAVPGPGPGPKQGPGPGGPKGGKMPGGPKPGGGPGLSTPGGHPKPPHRGGGEPRGGRQHHPPYHQQHHQGPPPGGPGGRSEEKISDSEGFKANLSLLRRPGEKTYTQRCRLFVGNLPADITEDEFKRLFAKYGEPGEVFINKGKGFGFIKLESRALAEIAKAELDDTPMRGRQLRVRFATHAAALSVRNLSPYVSNELLEEAFSQFGPIERAVVIVDDRGRSTGKGIVEFASKPAARKAFERCSEGVFLLTTTPRPVIVEPLEQLDDEDGLPEKLAQKNPMYQKERETPPRFAQHGTFEYEYSQRWKSLDEMEKQQREQVEKNMKDAKDKLESEMEDAYHEHQANLLRQDLMRRQEELRRMEELHNQEMQKRKEMQLRQEEERRRREEEMMIRQREMEEQMRRQREESYSRMGYMDPRERDMRMGGGGAMNMGDPYGSGGQKFPPLGGGGGIGYEANPGVPPATMSGSMMGSDMRTERFGQGGAGPVGGQGPRGMGPGTPAGYGRGREEYEGPNKKPRF DIP protein P23246 original sequence version: 182 6D8D5EA95E235847 hyep_human_gene Epoxide hydrolase 1 (EPHX1) human gene gene gene human Homo sapiens Human hnf4a-hyep 3 12 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role bait bait association association Fig. 5b P41235 increases expression at RNA level of ENSG00000143819 sfpq-hyep 3 12 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 11 unspecified role unspecified role bait bait association association Fig. 5b P23246 decreases expression at RNA level of ENSG00000143819 rxra-hyep 3 7 unspecified role unspecified role bait bait 12 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 5b sfpq-hnf4a 1 11 unspecified role unspecified role bait bait 8 unspecified role unspecified role prey prey physical association physical association Fig. 5a hnf4a-rxra 1 11 unspecified role unspecified role prey prey 8 unspecified role unspecified role bait bait physical association physical association Fig. 5a hyep-hnf4a 2 8 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). 6 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined c12a_g14t_a15t_g16c mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 1f hyep-hnf4a-1 2 6 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 8 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). 6 competitor competitor competitor prey prey c12a_g14t_a15t_g16c mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) association association Fig. 1f hyep-nr1i3 2 5 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). 9 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined g8c_g9t_t10g mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3f Q14994 increases expression at RNA level of ENSG00000143819 hyep-nr1i3-1 2 5 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). 9 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 9 competitor competitor competitor ancillary ancillary g8c_g9t_t10g mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) association association Fig. 3f Competition was seen to the middle and upper bands of the complex but not the lower band. hyep-sfpq 4 10 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). physical association physical association none