IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ X-linked thrombocytopenia caused by a novel mutation of GATA-1. X-linked thrombocytopenia caused by a novel mutation of GATA-1. Blood 2001 imex curation Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org 04-05-20: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro pull down pull down autoradiography autoradiography Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org Accepted 2020-FEB-04 AT 11:27 GMT AT 11:27 GMT by MGT Blood 2001 Only protein-protein interactions imex curation imex curation X-linked thrombocytopenia caused by a novel mutation of GATA-1. X-linked thrombocytopenia caused by a novel mutation of GATA-1. Blood 2001 imex curation Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org 04-05-20: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org Accepted 2020-FEB-04 AT 11:27 GMT AT 11:27 GMT by MGT Blood 2001 Only protein-protein interactions imex curation imex curation X-linked thrombocytopenia caused by a novel mutation of GATA-1. X-linked thrombocytopenia caused by a novel mutation of GATA-1. Blood 2001 imex curation Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org 04-05-20: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org Accepted 2020-FEB-04 AT 11:27 GMT AT 11:27 GMT by MGT Blood 2001 Only protein-protein interactions imex curation imex curation gata1_human Erythroid transcription factor GATA1 ERYF1 GF1 Eryf1 GATA-binding factor 1 NF-E1 DNA-binding protein protein protein human Homo sapiens Human MEFPGLGSLGTSEPLPQFVDPALVSSTPESGVFFPSGPEGLDAAASSTAPSTATAAAAALAYYRDAEAYRHSPVFQVYPLLNCMEGIPGGSPYAGWAYGKTGLYPASTVCPTREDSPPQAVEDLDGKGSTSFLETLKTERLSPDLLTLGPALPSSLPVPNSAYGGPDFSSTFFSPTGSPLNSAAYSSPKLRGTLPLPPCEARECVNCGATATPLWRRDRTGHYLCNACGLYHKMNGQNRPLIRPKKRLIVSKRAGTQCTNCQTTTTTLWRRNASGDPVCNACGLYYKLHQVNRPLTMRKDGIQTRNRKASGKGKKKRGSSLGGTGAAEGPAGGFMVVAGGSGSGNCGEVASGLTLGPPGTAHLYQGLGPVVLSGPVSHLMPFPGPLLGSPTGSFPTGPMPPTTSTTVVAPLSS DIP protein P15976 original sequence version: 163 DIP protein P15976 original sequence version: 113 DIP protein P15976 original sequence version: 146 822BD2DE14B908AD gata1_promoter_probe gata1_promoter dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GCGCTATCAGATAAGGCCTTG fog1_mouse Zinc finger protein ZFPM1 Zfpm1 Fog Fog1 Friend of GATA protein 1 Zinc finger protein multitype 1 protein protein mouse Mus musculus Mouse MSRRKQSNPRQIKRSLRDMEAGEEAKAMDSSPKEQEAPDPEAPAIEEPPSPPREDVSPPAVPAPPESPEDPEDMEGQELEMRPQDEEKEEKEEEAAMASPWSGPEELELALQDGQRCVRARLSLTEGLSWGPFYGSIQTRALSPEREEPGPAVTLMVDESCWLRMLPQVLTEEAANSEIYRKDDALWCRVTKVVPSGGLLYVRLVTEPHGAPRHPVQEPVEPGGLAPVHTDIQLLPQQAGMASILATAVINKDVFPCKDCGIWYRSERNLQAHLLYYCASRQRAGSPVSATEEKPKETYPNERVCPFPQCRKSCPSASSLEIHMRSHSGERPFVCLICLSAFTTKANCERHLKVHTDTLSGVCHNCGFISTTRDILYSHLVTNHMVCQPGSKGEIYSPGAGHPAAKLPPDSLAGFQQHSLMHSPLVPADKAPTPSSGLDSKAEVTNGETRVPPQNGGSSESPAAPRTIKVEAAEEPEATRASGPGEPGPQAPSRTPSPHSPNPVRVKTELSSPTPGSSPGPGELTMAGTLFLPQYVFSPDAGTTTVPTAPQASEILAKMSELVHNRLQQGAGSSGAAGTPTGLFSGTKGATCFECEITFNNINNFYVHKRLYCSGRRAPEDPPTVRRPKAATGPARAPAGAAAEPDPSRSSPGPGPREEEASGTTTPEAEAAGRGSEGSQSPGSSVDDAEDDPSRTLCEACNIRFSRHETYTVHKRYYCASRHDPPPRRPPAPTTAPGPAAPALTAPPVRTRRRRKLYELPAAGAPPPAAGPAPVPVVPSPTAELPSSPRPGSASAGPAPALSPSPVPDGPIDLSKRPRRQSPDAPTALPALADYHECTACRVSFHSLEAYLAHKKYSCPAAPLRTTALCPYCPPNGRVRGDLVEHLRQAHGLQVAKPAASPGAEPRTPAERAPRDSPDGRAPRSPSPAPENTPSDPADQGARTPSKGPPAPAPAPGGGGGHRYCRLCNIRFSSLSTFIAHKKYYCSSHAAEHVK DIP protein O35615 original sequence version: 82 293255B28151ECB8 gata1-gata1_promoter-1 3 4 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed cell lysate cell lysate P15976:p.Gly208Ser mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain G S Tue Jun 30 16:33:48 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly208Ser' mouse-ba_f3 Mouse pro B cells IL-3 dependent mouse-baf3 EBI-6922762 ba_f3 Mouse pro B cells IL-3 dependent BA/F3 baf3 5 unspecified role unspecified role bait bait purified purified chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Figure 6 gata1-zfpm1-3 1 4 unspecified role unspecified role prey prey cell lysate cell lysate in vitro translated in vitro translated protein in vitro translated region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined P15976:p.Gly208Ser mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain G S Tue Jun 30 16:33:03 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly208Ser' rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes 6 unspecified role unspecified role bait bait purified purified n-terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range zinc finger 1 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) physical association physical association Figure 8a zfpm1-gata1-3 1 4 unspecified role unspecified role prey prey cell lysate cell lysate in vitro translated in vitro translated protein in vitro translated region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined P15976:p.Gly208Ser mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain G S Tue Jun 30 17:11:01 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly208Ser' rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes 6 unspecified role unspecified role bait bait purified purified n-terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range zinc finger 6 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) physical association physical association Figure 8a zfpm1-gata1-4 1 4 unspecified role unspecified role prey prey cell lysate cell lysate in vitro translated in vitro translated protein in vitro translated region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined P15976:p.Gly208Ser mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G S Tue Jun 30 16:11:33 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly208Ser' rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes 6 unspecified role unspecified role bait bait purified purified n-terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range zinc finger 9 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) physical association physical association Figure 8a gata1-zfpm1-4 2 4 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell P15976:p.Gly208Ser mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain G S Tue Jun 30 19:22:58 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly208Ser' 6 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed living cell living cell zinc finger 1 binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain zinc finger 6 binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain physical association physical association Figure 8C gata1-zfpm1-5 2 4 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell P15976:p.Gly208Ser mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G S Tue Jun 30 16:15:30 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly208Ser' 6 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed living cell living cell zinc finger 9 binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain physical association physical association Figure 8C