IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death. Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death. Journal of neuroinflammation 2014 imex curation Yang S., Gao L., Lu F., Wang B., Gao F., Zhu G., Cai Z., Lai J., Yang Q. Parkinsons - Interactions investigated in the context of Parkinsons disease IBD - Inflammatory bowel disease qianyang@fmmu.edu.cn 20-Dec-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-bv2 Mouse BV2 glioma cells bv2 Mouse microglial BV2 cells mouse, C57BL/6; Tissue: brain, microglial cells; Transformed by: retroviruses; transformed by recombinant retrovirus (v-raf/v-mic) ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Yang S., Gao L., Lu F., Wang B., Gao F., Zhu G., Cai Z., Lai J., Yang Q. Parkinsons - Interactions investigated in the context of Parkinsons disease qianyang@fmmu.edu.cn Accepted 2016-NOV-08 AT 11:22 GMT AT 11:22 GMT by PPORRAS Journal of neuroinflammation 2014 Only protein-protein interactions imex curation imex curation Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death. Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death. Journal of neuroinflammation 2014 imex curation Yang S., Gao L., Lu F., Wang B., Gao F., Zhu G., Cai Z., Lai J., Yang Q. Parkinsons - Interactions investigated in the context of Parkinsons disease IBD - Inflammatory bowel disease qianyang@fmmu.edu.cn 20-Dec-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-bv2 Mouse BV2 glioma cells bv2 Mouse microglial BV2 cells mouse, C57BL/6; Tissue: brain, microglial cells; Transformed by: retroviruses; transformed by recombinant retrovirus (v-raf/v-mic) ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Yang S., Gao L., Lu F., Wang B., Gao F., Zhu G., Cai Z., Lai J., Yang Q. Parkinsons - Interactions investigated in the context of Parkinsons disease qianyang@fmmu.edu.cn Accepted 2016-NOV-08 AT 11:22 GMT AT 11:22 GMT by PPORRAS Journal of neuroinflammation 2014 Only protein-protein interactions imex curation imex curation Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death. Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death. Journal of neuroinflammation 2014 imex curation Yang S., Gao L., Lu F., Wang B., Gao F., Zhu G., Cai Z., Lai J., Yang Q. Parkinsons - Interactions investigated in the context of Parkinsons disease IBD - Inflammatory bowel disease qianyang@fmmu.edu.cn 20-Dec-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag visualisation tag visualisation Yang S., Gao L., Lu F., Wang B., Gao F., Zhu G., Cai Z., Lai J., Yang Q. Parkinsons - Interactions investigated in the context of Parkinsons disease qianyang@fmmu.edu.cn Accepted 2016-NOV-08 AT 11:22 GMT AT 11:22 GMT by PPORRAS Journal of neuroinflammation 2014 Only protein-protein interactions imex curation imex curation mef2d_mouse Myocyte-specific enhancer factor 2D Mef2d protein protein mouse Mus musculus Mouse MGRKKIQIQRITDERNRQVTFTKRKFGLMKKAYELSVLCDCEIALIIFNHSNKLFQYASTDMDKVLLKYTEYNEPHESRTNADIIETLRKKGFNGCDSPEPDGEDSLEQSPLLEDKYRRASEELDGLFRRYGSSVPAPNFAMPVTVPVSNQSSMQFSNPSSSLVTPSLVTSSLTDPRLLSPQQPALQRNSVSPGLPQRPASAGAMLGGDLNSANGACPSPVGNGYVSARASPGLLPVANGNSLNKVIPAKSPPPPTHNTQLGAPSRKPDLRVITSQGGKGLMHHLTEDHLDLNNAQRLGVSQSTHSLTTPVVSVATPSLLSQGLPFSSMPTAYNTDYQLPSAELSSLPAFSSPAGLALGNVTAWQQPQPPQQPQPPQPPQSQPQPPQPQPQQPPQQQPHLVPVSLSNLIPGSPLPHVGAALTVTTHPHISIKSEPVSPSRERSPAPPPPAVFPAARPEPGEGLSSPAGGSYETGDRDDGRGDFGPTLGLLRPAPEPEAEGSAVKRMRLDTWTLK 34833264CE22C63F il10_mouse_gene Interleukin-10 gene gene gene mouse Mus musculus Mouse mef2_binding_consensus_ site_probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid mouse Mus musculus Mouse TCGACGGGCTATTTTTAGGGCC mef2_binding_consensus_ site_probe-mef2d-1 3 6 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role prey prey mouse-bv2 Mouse BV2 glioma cells bv2 Mouse microglial BV2 cells mouse, C57BL/6; Tissue: brain, microglial cells; Transformed by: retroviruses; transformed by recombinant retrovirus (v-raf/v-mic) physical association physical association 2C mef2d-il10_mouse_gene-1 2 5 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait association association 3 D CHEBI:16412 (LPS) CHEBI:16412 increases the binding of Q63943 to ENSMUSG00000016529 CHEBI:16412 increases the expression at protein level of Q63943 CHEBI:16412 increases the expression at RNA level of ENSMUSG00000016529 causality from Figs 3/4 Q63943 increases the expression at RNA level of ENSMUSG00000016529 Q63943 increases the expression at protein level of ENSMUSG00000016529 mef2d-il10_mouse_gene-2 1 5 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait association association 3 C CHEBI:16412 (LPS)