IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Wilms' tumor protein Wt1 regulates the Interleukin-10 (IL-10) gene. Wilms' tumor protein Wt1 regulates the Interleukin-10 (IL-10) gene. FEBS letters 2010 imex curation Sciesielski LK., Kirschner KM., Scholz H., Persson AB. IBD - Inflammatory bowel disease anja.bondke@charite.de 19-Jan-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa anti tag western anti tag western blot anti tag western Sciesielski LK., Kirschner KM., Scholz H., Persson AB. IBD - Inflammatory bowel disease The (EMSA) methods section states that "purified recombinant GST-Wt1 protein [17]" were used;however no GST tagged WT1 protein is mentioned in this reference which relates to Murine WT1. Sequences for EMSA probes are given in Methods (EMSA) section and also in Table 1. Sequences from table 1 have been used here as these are longer. No identifiers are stated for the WT-1 proteins used in this publication;the Wt-1 protein with "KTS" (aas 408-410) has been annotated as p22561-1 and the protein without "KTS" has been annotated as p22561-4; this is an arbitrary decision as several isoforms exist both with and without the "KTS" sequence. anja.bondke@charite.de Accepted 2015-DEC-07 AT 12:44 GMT AT 12:44 GMT by ORCHARD FEBS letters 2010 Only protein-protein interactions imex curation imex curation Wilms' tumor protein Wt1 regulates the Interleukin-10 (IL-10) gene. Wilms' tumor protein Wt1 regulates the Interleukin-10 (IL-10) gene. FEBS letters 2010 imex curation Sciesielski LK., Kirschner KM., Scholz H., Persson AB. IBD - Inflammatory bowel disease anja.bondke@charite.de 19-Jan-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-m-15 mouse M15 cells Mouse m-15 M15-mouse mesonephric epithelium, polyoma virus large T transformed Cell Line WT1-expressing ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Sciesielski LK., Kirschner KM., Scholz H., Persson AB. IBD - Inflammatory bowel disease Interactions involving acetylated-H3 have not been included due to lack of antibody specificity. I have had to create the m15 cell line as "m-15" because "m15" has already been entered -as an E.coli strain; I cannot locate the "expressed ins" to alter or remove!- have asked Max for their locations - am waiting..... anja.bondke@charite.de Accepted 2015-DEC-07 AT 12:44 GMT AT 12:44 GMT by ORCHARD FEBS letters 2010 Only protein-protein interactions imex curation imex curation il10_mouse_gene Interleukin-10 gene gene gene mouse Mus musculus Mouse il-10_proximal_promoter_probe ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TTAGAAGAGGGAGGAGGAGCCTGAAT sp1_human Transcription factor Sp1 SP1 TSFP1 protein protein human Homo sapiens Human MSDQDHSMDEMTAVVKIEKGVGGNNGGNGNGGGAFSQARSSSTGSSSSTGGGGQESQPSPLALLAATCSRIESPNENSNNSQGPSQSGGTGELDLTATQLSQGANGWQIISSSSGATPTSKEQSGSSTNGSNGSESSKNRTVSGGQYVVAAAPNLQNQQVLTGLPGVMPNIQYQVIPQFQTVDGQQLQFAATGAQVQQDGSGQIQIIPGANQQIITNRGSGGNIIAAMPNLLQQAVPLQGLANNVLSGQTQYVTNVPVALNGNITLLPVNSVSAATLTPSSQAVTISSSGSQESGSQPVTSGTTISSASLVSSQASSSSFFTNANSYSTTTTTSNMGIMNFTTSGSSGTNSQGQTPQRVSGLQGSDALNIQQNQTSGGSLQAGQQKEGEQNQQTQQQQILIQPQLVQGGQALQALQAAPLSGQTFTTQAISQETLQNLQLQAVPNSGPIIIRTPTVGPNGQVSWQTLQLQNLQVQNPQAQTITLAPMQGVSLGQTSSSNTTLTPIASAASIPAGTVTVNAAQLSSMPGLQTINLSALGTSGIQVHPIQGLPLAIANAPGDHGAQLGLHGAGGDGIHDDTAGGEEGENSPDAQPQAGRRTRREACTCPYCKDSEGRGSGDPGKKKQHICHIQGCGKVYGKTSHLRAHLRWHTGERPFMCTWSYCGKRFTRSDELQRHKRTHTGEKKFACPECPKRFMRSDHLSKHIKTHQNKKGGPGVALSVGTLPLDSGAGSEGSGTATPSALITTNMVAMEAICPEGIARLANSGINVMQVADLQSINISGNGF DIP protein P08047 original sequence version: 185 DIP protein P08047 original sequence version: 187 DIP protein P08047 original sequence version: 181 DIP protein P08047 original sequence version: 162 DIP protein P08047 original sequence version: 161 43893DBF6518B9EA vdr_promoter_probe ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TGAACTTAGTGGGCGTGGTTG p22561-1 Wilms tumor protein homolog Wt1 Wt-1 protein protein mouse Mus musculus Mouse MGSDVRDLNALLPAVSSLGGGGGGCGLPVSGARQWAPVLDFAPPGASAYGSLGGPAPPPAPPPPPPPPHSFIKQEPSWGGAEPHEEQCLSAFTLHFSGQFTGTAGACRYGPFGPPPPSQASSGQARMFPNAPYLPSCLESQPTIRNQGYSTVTFDGAPSYGHTPSHHAAQFPNHSFKHEDPMGQQGSLGEQQYSVPPPVYGCHTPTDSCTGSQALLLRTPYSSDNLYQMTSQLECMTWNQMNLGATLKGMAAGSSSSVKWTEGQSNHGIGYESENHTAPILCGAQYRIHTHGVFRGIQDVRRVSGVAPTLVRSASETSEKRPFMCAYPGCNKRYFKLSHLQMHSRKHTGEKPYQCDFKDCERRFSRSDQLKRHQRRHTGVKPFQCKTCQRKFSRSDHLKTHTRTHTGKTSEKPFSCRWHSCQKKFARSDELVRHHNMHQRNMTKLHVAL Detected in nucleus speckle, may bind mRNA. 962381E9C8D7A380 p22561-4 Wilms tumor protein homolog Wt1 Wt-1 protein protein mouse Mus musculus Mouse MGSDVRDLNALLPAVSSLGGGGGGCGLPVSGARQWAPVLDFAPPGASAYGSLGGPAPPPAPPPPPPPPHSFIKQEPSWGGAEPHEEQCLSAFTLHFSGQFTGTAGACRYGPFGPPPPSQASSGQARMFPNAPYLPSCLESQPTIRNQGYSTVTFDGAPSYGHTPSHHAAQFPNHSFKHEDPMGQQGSLGEQQYSVPPPVYGCHTPTDSCTGSQALLLRTPYSSDNLYQMTSQLECMTWNQMNLGATLKGMAAGSSSSVKWTEGQSNHGIGYESENHTAPILCGAQYRIHTHGVFRGIQDVRRVSGVAPTLVRSASETSEKRPFMCAYPGCNKRYFKLSHLQMHSRKHTGEKPYQCDFKDCERRFSRSDQLKRHQRRHTGVKPFQCKTCQRKFSRSDHLKTHTRTHTGEKPFSCRWHSCQKKFARSDELVRHHNMHQRNMTKLHVAL Detected in nucleoplasm, probably functions as transcription factor. E1D76ECAE93FB51D wt1_mouse Wilms tumor protein homolog Wt1 Wt-1 protein protein mouse Mus musculus Mouse MGSDVRDLNALLPAVSSLGGGGGGCGLPVSGARQWAPVLDFAPPGASAYGSLGGPAPPPAPPPPPPPPHSFIKQEPSWGGAEPHEEQCLSAFTLHFSGQFTGTAGACRYGPFGPPPPSQASSGQARMFPNAPYLPSCLESQPTIRNQGYSTVTFDGAPSYGHTPSHHAAQFPNHSFKHEDPMGQQGSLGEQQYSVPPPVYGCHTPTDSCTGSQALLLRTPYSSDNLYQMTSQLECMTWNQMNLGATLKGMAAGSSSSVKWTEGQSNHGIGYESENHTAPILCGAQYRIHTHGVFRGIQDVRRVSGVAPTLVRSASETSEKRPFMCAYPGCNKRYFKLSHLQMHSRKHTGEKPYQCDFKDCERRFSRSDQLKRHQRRHTGVKPFQCKTCQRKFSRSDHLKTHTRTHTGKTSEKPFSCRWHSCQKKFARSDELVRHHNMHQRNMTKLHVAL Potential role in transcriptional regulation. Recognizes and binds to the DNA sequence 5'-CGCCCCCGC-3' mint 962381E9C8D7A380 il_10_proximal_promoter_probe-wt1-1 1 8 unspecified role unspecified role prey prey possible _tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait G10T,G11T,G14T,G17T mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain G T certain certain sequence position certain certain certain sequence position certain GG TT certain certain sequence position certain certain certain sequence position certain G T 3_prime_digoxigenin_tag tag tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction 4 A/B il_10_proximal_promoter_probe-wt1-2 1 6 competitor competitor competitor unspecified role unspecified role 8 unspecified role unspecified role prey prey possible _tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait 3_prime_digoxigenin_tag tag tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association 4Ai il_10_proximal_promoter_probe-wt1-3 1 7 unspecified role unspecified role prey prey possible _tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait G10T,G11T,G14T,G17T mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain G T certain certain sequence position certain certain certain sequence position certain GG TT certain certain sequence position certain certain certain sequence position certain G T 3_prime_digoxigenin_tag tag tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction 4Aii il_10_proximal_promoter_probe-sp1-1 1 5 unspecified role unspecified role prey prey spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 4 unspecified role unspecified role bait bait 3_prime_digoxigenin_tag tag tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction 4 B weak binding was seen. wt1-il10_mouse_gene-1 2 9 unspecified role unspecified role bait bait 3 unspecified role unspecified role prey prey proximal_promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 5A The two antibodies used detected epitopes at the C-terminus and an "internal region" of WT1; no isoforms specified. P22561 increased at RNA level the expression of ENSMUSG00000016529 caus. from Fig 2 wt1-il10_mouse_gene-2 2 5 unspecified role unspecified role bait bait 3 unspecified role unspecified role prey prey proximal_promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 5Ai