IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Nature 2010 imex curation Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease [I cannot SAVE this comment at Interaction level ] I have taken the Required to bind feature from Fig 1G AND Supp Table 1 List of Probes: Supp Table sequence for the "minimal C-REL motif" is two nucleotides longer than that given on fig 1G - which did they use? [The DELTA-RELC construct sequence is the SAME as the CNS3_WT sequence (error!) - so it is not poss to tell which they used! Nuclear lysates from unstimulated or stimulated (CD3 and CD28 antibodies, and TGF-beta) CD4+CD25- mouse (Naive) T cells from lymph nodes and spleen. (Stimulated cells become induced TReg cells). rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. Accepted 2015-OCT-07 AT 09:41 BST AT 09:41 BST by ORCHARD Nature 2010 Only protein-protein interactions imex curation imex curation Figure 4H only uses NAturally occurring TReg cells apart from one interaction - which is entered here. I have amalgamated the separate interactions for Fig 4h as requested. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Nature 2010 imex curation Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease Naturally occurring - Wild-type -CD4+CD25+ (regulatory) mouse T cells, and Induced TReg cells (CD4+CD25- cells treated with anti-CD3/28 + TGF-beta) rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. Accepted 2015-OCT-07 AT 09:41 BST AT 09:41 BST by ORCHARD Nature 2010 Only protein-protein interactions imex curation imex curation Figure 4H only uses NAturally occurring TReg cells apart from one interaction - which is entered here. I have amalgamated the separate interactions for Fig 4h as requested. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Nature 2010 imex curation Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease Nuclear extracts from CD4+CD25+ (regulatory) mouse T cells. rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. Accepted 2015-OCT-07 AT 09:41 BST AT 09:41 BST by ORCHARD Nature 2010 Only protein-protein interactions imex curation imex curation Figure 4H only uses NAturally occurring TReg cells apart from one interaction - which is entered here. I have amalgamated the separate interactions for Fig 4h as requested. pde3b_mouse_gene Pde3b gene gene mouse Mus musculus Mouse ikzf2_mouse_gene Zinc finger protein Helios Ikzf2 Helios Zfpn1a2 Znfn1a2 gene gene mouse Mus musculus Mouse runx1_mouse Runt-related transcription factor 1 Runx1 Aml1 Cbfa2 Pebp2ab Acute myeloid leukemia 1 protein Core-binding factor subunit alpha-2 Oncogene AML-1 Polyomavirus enhancer-binding protein 2 alpha B subunit SL3-3 enhancer factor 1 alpha B subunit SL3/AKV core-binding factor alpha B subunit protein protein mouse Mus musculus Mouse MRIPVDASTSRRFTPPSTALSPGKMSEALPLGAPDGGPALASKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDARQIQPSPPWSYDQSYQYLGSITSSSVHPATPISPGRASGMTSLSAELSSRLSTAPDLTAFGDPRQFPTLPSISDPRMHYPGAFTYSPPVTSGIGIGMSAMSSASRYHTYLPPPYPGSSQAQAGPFQTGSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGAALLNPSLPSQSDVVETEGSHSNSPTNMPPARLEEAVWRPY DIP protein Q03347 original sequence version: 136 DIP protein Q03347 original sequence version: 128 foxo3_mouse Forkhead box protein O3 Foxo3 Fkhr2 Foxo3a protein protein mouse Mus musculus Mouse MAEAPASPVPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEDDDEDDEDGGGRASSAMVIGGGVSSTLGSGLLLEDSAMLLAPGGQDLGSGPASAAGALSGGTPTQLQPQQPLPQPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQAAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPILASTELDDVQDDDGPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLAENLMDDLLDNIALPPSQPSPPGGLMQRGSSFPYTAKSSGLGSPTGSFNSTVFGPSSLNSLRQSPMQTIQENRPATFSSVSHYGNQTLQDLLASDSLSHSDVMMTQSDPLMSQASTAVSAQNARRNVMLRNDPMMSFAAQPTQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSDSSSLGSAKHQQQSPASQSMQTLSDSLSGSSLYSASANLPVMGHDKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG EC218D9BA0C1DAC5 foxp3_enhancer/cns3_probe_wt CNS3_WT_probe ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse GTGAGGCCCGGGGCCCAGAATGGGGTAAGCAGGGTGGGGTACTTGGGCCTATAGGTGTCGACCTTTACTGTGGCATGTGGCGGGGGGGGGGGGGGGGGCTGGGGCACAGGAAGTGGTTTATGGGTCCCAGGCAAGTCTGACTTATGCAGATATTGCAGGGCCAAGAAAATCCCCACTCTCCAGGCTTCAGAGATTCAAGGCTTTCCCCACCCCTCCCAATCCTCATCCCGATAG foxp3_enhancer/cns2_probe_wt ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TGGGTTTTGCATGGTAGCCAGATGGACGTCACCTACCACATCCGCTAGCACCCACATCACCCTACCTGGGCCTATCCGGCTACAGGATAGACTAGCCACTTCTCGGAACGAAACCTGTGGGGTAGATTATCTGCCCCCTTCTCTTCCTCCTTGTTGCCGATGAAGCCCAATGCATCCGGCCGCCATGACGTCAATGGCAGAAAAATCTGGCCAAGTTCAGGTTGTGACAACAGGGCCCAGATGTAGACCCCGATAGGAAAACATATTCTATGTCCCAGAAACAACCTCCATACAGCTTCTAAGAAACAGTCAAACAGGAACGCCCCAACAGACAGTGCAGGAAGCTGGCTGGCCAGCCCAGCCCTCCAGGTCCCTAGTACCACTAGACAGACCATATCCAATTCAGGTCCTCTTTCTGAGAATGTA il-2 cd28re_probe IL-2 CD28RE ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TAAAGAAATTCCAGA pebb_mouse Core-binding factor subunit beta Polyomavirus enhancer-binding protein 2 beta subunit SL3-3 enhancer factor 1 subunit beta SL3/AKV core-binding factor beta subunit Cbfb Pebp2b Pebpb2 protein protein mouse Mus musculus Mouse MPRVVPDQRSKFENEEFFRKLSRECEIKYTGFRDRPHEERQTRFQNACRDGRSEIAFVATGTNLSLQFFPASWQGEQRQTPSREYVDLEREAGKVYLKAPMILNGVCVIWKGWIDLHRLDGMGCLEFDEERAQQEDALAQQAFEEARRRTREFEDRDRSHREEMEARRQQDPSPGSNLGGGDDLKLR 0B2E6101A35D0FD8 demethylated_foxp3_enhancer/cns2_probe_wt ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TGGGTTTTGCATGGTAGCCAGATGGACGTCACCTACCACATCCGCTAGCACCCACATCACCCTACCTGGGCCTATCCGGCTACAGGATAGACTAGCCACTTCTCGGAACGAAACCTGTGGGGTAGATTATCTGCCCCCTTCTCTTCCTCCTTGTTGCCGATGAAGCCCAATGCATCCGGCCGCCATGACGTCAATGGCAGAAAAATCTGGCCAAGTTCAGGTTGTGACAACAGGGCCCAGATGTAGACCCCGATAGGAAAACATATTCTATGTCCCAGAAACAACCTCCATACAGCTTCTAAGAAACAGTCAAACAGGAACGCCCCAACAGACAGTGCAGGAAGCTGGCTGGCCAGCCCAGCCCTCCAGGTCCCTAGTACCACTAGACAGACCATATCCAATTCAGGTCCTCTTTCTGAGAATGTA foxo3_mouse_gene Forkhead box protein O3 Foxo3 Fkhr2 Foxo3a gene gene mouse Mus musculus Mouse 5ntd_mouse_gene 5'-nucleotidase Nt5e Nt5 Nte gene gene mouse Mus musculus Mouse rel_mouse Proto-oncogene c-Rel Rel protein protein mouse Mus musculus Mouse MASSGYNPYVEIIEQPRQRGMRFRYKCEGRSAGSIPGERSTDNNRTYPSVQIMNYYGKGKIRITLVTKNDPYKPHPHDLVGKDCRDGYYEAEFGPERRPLFFQNLGIRCVKKKEVKGAIILRISAGINPFNVGEQQLLDIEDCDLNVVRCVFMFFLPDEDGNFTTALPPIVSNPIYDNRAPNTAELRICRVNKNCGSVRGGDEIFLLCDKVQKDDIEVRFVLNDWEARGVFSQADVHRQVAIVFKTPPYCKAILEPVTVKMQLRRPSDQEVSESMDFRYLPDEKDAYGNKSKKQKTTLIFQKLLQDCGHFTEKPRTAPLGSTGEGRFIKKESNLFSHGTVLPEMPRSSGVPGQAEPYYSSCGSISSGLPHHPPAIPSVAHQPTSWPPVTHPTSHPVSTNTLSTFSAGTLSSNSQGILPFLEGPGVSDLSASNSCLYNPDDLARMETPSMSPTDLYSISDVNMLSTRPLSVMAPSTDGMGDTDNPRLVSINLENPSCNARLGPRDLRQLHQMSPASLSAGTSSSSVFVSQSDAFDRSNFSCVDNGLMNEPGLSDDANNPTFVQSSHYSVNTLQSEQLSDPFTYGFFKI DIP protein P15307 original sequence version: 88 98FC237B6D140416 cns3_probe_wt-rel-1 1 8 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined cns3_cRel_motif required to bind necessary binding region required to bind range range range range chemical synthesis Chemical synthesis (Chemical synthesis) 15 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association 1H CD3/C28 antibodies + TGF-beta:NO Rel binding was seen in the absence of this stimulation. cns3_probe_wt-rel-2 1 10 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 15 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association 1Hi CD3/C28 antibodies + TGF-beta;interaction was seen in the presence AND absence of stimulation. Fig 1G again gives a shorter construct for the CD28RE probe than the Supp Table 1- entered sequence here from S. Table 1 Positive control foxp3_enhancer/cns3_probe_wt-rel-1 3 9 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 7 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association 4D No binding of the CNS2 probe was seen using naive (CD4+CD25-) T cells. foxo3-1 2 13 unspecified role unspecified role prey prey cns2/enhancer_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role bait bait association association 4E, G, I Induced TRegs (stimulated with anti-CD3/28+TGF-beta) did not demonstrate this interaction. Q08024 increased the binding of Q9WVH4 to ENSMUSG00000048756 foxo3-ikzf2_mouse_gene-1 2 5 unspecified role unspecified role prey prey 7 unspecified role unspecified role bait bait association association 4Ei,4I Positive control foxo3-pde3b-1 2 4 unspecified role unspecified role prey prey 7 unspecified role unspecified role bait bait association association 4G Positive control;both naturally occurring and Induced TRegs (stimulated with anti-CD3/28+TGF-beta) demonstrated this interaction. demethylated_foxp3_enhancer/cns2_probe_wt-cbfb-1 1 12 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association 4H Binding of the demethylated CNS2 probe to Cbf-beta/Pebb was seen using both naive (CD4+CD25-) and TReg (CD4+CD25+) T cells. demethylated_foxp3_enhancer/cns2_probe_wt-cbfb-2 3 6 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes 12 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 7 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes 11 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes association association 4Hi Binding of Cbf-beta/Pebb was seen using methylated and demethylated probes. foxo3-nt5e-1 2 14 unspecified role unspecified role prey prey 7 unspecified role unspecified role bait bait association association 4I Positive control