IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Hepatocyte nuclear factor-4alpha and bile acids regulate human concentrative nucleoside transporter-1 gene expression. Hepatocyte nuclear factor-4alpha and bile acids regulate human concentrative nucleoside transporter-1 gene expression. Am. J. Physiol. Gastrointest. Liver Physiol. (0193-1857) 2009 imex curation Klein K., Kullak-Ublick G.A., Wagner M., Trauner M., Eloranta J.J. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease jyrki.eloranta@usz.ch 12-Nov-2014: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Klein K., Kullak-Ublick G.A., Wagner M., Trauner M., Eloranta J.J. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis jyrki.eloranta@usz.ch Accepted 2014-OCT-30 by ORCHARD Am. J. Physiol. Gastrointest. Liver Physiol. (0193-1857) 2009 Only protein-protein interactions imex curation s28a1_human_dr1-1_dna-probe Human S28A1 gene promoter HNF4a regulatory cis-element DR1 (-76/-54) DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGTGGAGACCTTTGGGCTCCAAG hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI 5F1309B89D95DCAF s28a1_human_dr1-2_dna-probe Human S28A1 gene promoter HNF4a regulatory cis-element DR1 (-60/-38) DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CTCCAAGCTCAAGGTCCACCCCA s28a1_human_dr1-1+2_dna-probe Human S28A1 gene promoter HNF4a regulatory cis-element DR1 (-76/-38) DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGTGGAGACCTTTGGGCTCCAAGCTCAAGGTCCACCCCA s28a1-hnf4a-2 1 3 unspecified role unspecified role prey prey human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma 5 unspecified role unspecified role bait bait agacctttgggctccaagctcaaggtcca-to-atactttttggttccaaactaaagatcaa mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 5a P41235 increases expression at RNA level of ENSG00000156222 s28a1-hnf4a-3 1 3 unspecified role unspecified role prey prey human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma 2 unspecified role unspecified role bait bait agacctttgggctccaag-to-atactttttggttccaaa mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 5a s28a1-hnf4a-1 1 4 unspecified role unspecified role bait bait ctccaagctcaaggtcca-to-ttccaaactaaagatcaa mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 3 unspecified role unspecified role prey prey human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma physical association physical association Fig. 5a