IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Molecular mechanisms of IL-18BP regulation in DLD-1 cells: pivotal direct action of the STAT1/GAS axis on the promoter level. Molecular mechanisms of IL-18BP regulation in DLD-1 cells: pivotal direct action of the STAT1/GAS axis on the promoter level. J. Cell. Mol. Med. (1582-1838) 2009 imex curation Bachmann M., Paulukat J., Pfeilschifter J., Mühl H. IBD - Inflammatory bowel disease H.Muehl@em.uni-frankfurt.de 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-dld1 Human colorectal adenocarcinoma dld1 Human colon adenocarcinoma ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Bachmann M., Paulukat J., Pfeilschifter J., Mühl H. IBD - Inflammatory bowel disease H.Muehl@em.uni-frankfurt.de Accepted 2014-NOV-12 by ORCHARD J. Cell. Mol. Med. (1582-1838) 2009 Only protein-protein interactions imex curation Molecular mechanisms of IL-18BP regulation in DLD-1 cells: pivotal direct action of the STAT1/GAS axis on the promoter level. Molecular mechanisms of IL-18BP regulation in DLD-1 cells: pivotal direct action of the STAT1/GAS axis on the promoter level. J. Cell. Mol. Med. (1582-1838) 2009 imex curation Bachmann M., Paulukat J., Pfeilschifter J., Mühl H. IBD - Inflammatory bowel disease H.Muehl@em.uni-frankfurt.de 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Bachmann M., Paulukat J., Pfeilschifter J., Mühl H. IBD - Inflammatory bowel disease H.Muehl@em.uni-frankfurt.de Accepted 2014-NOV-12 by ORCHARD J. Cell. Mol. Med. (1582-1838) 2009 Only protein-protein interactions imex curation i18bp_human_gas-site_dna-probe Human I18BP gene promoter gamma-activated sequence DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CAGTGCTTTCCCAGAAGGATTGC i18bp_human_gene Interleukin-18-binding protein (I18BP) human gene gene gene human Homo sapiens Human stat1_human Signal transducer and activator of transcription 1-alpha/beta STAT1 Transcription factor ISGF-3 components p91/p84 protein protein human Homo sapiens Human MSQWYELQQLDSKFLEQVHQLYDDSFPMEIRQYLAQWLEKQDWEHAANDVSFATIRFHDLLSQLDDQYSRFSLENNFLLQHNIRKSKRNLQDNFQEDPIQMSMIIYSCLKEERKILENAQRFNQAQSGNIQSTVMLDKQKELDSKVRNVKDKVMCIEHEIKSLEDLQDEYDFKCKTLQNREHETNGVAKSDQKQEQLLLKKMYLMLDNKRKEVVHKIIELLNVTELTQNALINDELVEWKRRQQSACIGGPPNACLDQLQNWFTIVAESLQQVRQQLKKLEELEQKYTYEHDPITKNKQVLWDRTFSLFQQLIQSSFVVERQPCMPTHPQRPLVLKTGVQFTVKLRLLVKLQELNYNLKVKVLFDKDVNERNTVKGFRKFNILGTHTKVMNMEESTNGSLAAEFRHLQLKEQKNAGTRTNEGPLIVTEELHSLSFETQLCQPGLVIDLETTSLPVVVISNVSQLPSGWASILWYNMLVAEPRNLSFFLTPPCARWAQLSEVLSWQFSSVTKRGLNVDQLNMLGEKLLGPNASPDGLIPWTRFCKENINDKNFPFWLWIESILELIKKHLLPLWNDGCIMGFISKERERALLKDQQPGTFLLRFSESSREGAITFTWVERSQNGGEPDFHAVEPYTKKELSAVTFPDIIRNYKVMAAENIPENPLKYLYPNIDKDHAFGKYYSRPKEAPEPMELDGPKGTGYIKTELISVSEVHPSRLQTTDNLLPMSPEEFDEVSRIVGSVEFDSMMNTV 054A813522364BA6 stat1-i18bp-1 1 4 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role bait bait association association Fig. 2d P42224 increases expression at RNA level of ENSG00000137496 Interferon gamma (IFN-gamma) (P01579) No IL18BP gene promoter DNA was co-precipitated with anti-STAT1 antibody from cells that were not stimulated with IFN-gamma. P01579 increases binding of P42224 to ENSG00000137496 i18bp-stat1-1 2 5 unspecified role unspecified role prey prey human-dld1 Human colorectal adenocarcinoma dld1 Human colon adenocarcinoma 3 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 2c Interferon gamma (IFN-gamma) (P01579) The interaction was not observed with nuclear extracts from cells that were not stimulated with IFN-gamma.