IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Protein kinase C delta induces transcription of the TP53 tumor suppressor gene by controlling death-promoting factor Btf in the apoptotic response to DNA damage. Protein kinase C delta induces transcription of the TP53 tumor suppressor gene by controlling death-promoting factor Btf in the apoptotic response to DNA damage. Mol. Cell. Biol. (0270-7306) 2007 imex curation Liu H., Lu Z.G., Miki Y., Yoshida K. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease Apoptosis - Interactions involving proteins with a function related to apoptosis yos.mgen@mri.tmd.ac.jp 19-Jun-2012: Contacted by JYOTI. Only protein-protein interactions human-molt-4 Homo sapiens MOLT-4 T-cell leukaemia line molt-4 Human T cell leukemia ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Liu H., Lu Z.G., Miki Y., Yoshida K. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease Apoptosis - Interactions involving proteins with a function related to apoptosis yos.mgen@mri.tmd.ac.jp Accepted 2012-FEB-10 by JYOTI 19-Jun-2012: Contacted by JYOTI. Mol. Cell. Biol. (0270-7306) 2007 Only protein-protein interactions imex curation Protein kinase C delta induces transcription of the TP53 tumor suppressor gene by controlling death-promoting factor Btf in the apoptotic response to DNA damage. Protein kinase C delta induces transcription of the TP53 tumor suppressor gene by controlling death-promoting factor Btf in the apoptotic response to DNA damage. Mol. Cell. Biol. (0270-7306) 2007 imex curation Liu H., Lu Z.G., Miki Y., Yoshida K. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease Apoptosis - Interactions involving proteins with a function related to apoptosis yos.mgen@mri.tmd.ac.jp 19-Jun-2012: Contacted by JYOTI. Only protein-protein interactions chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 pull down pull down ms participant Identification by mass spectrometry ms participant Liu H., Lu Z.G., Miki Y., Yoshida K. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease Apoptosis - Interactions involving proteins with a function related to apoptosis yos.mgen@mri.tmd.ac.jp Accepted 2012-FEB-10 by JYOTI Mol. Cell. Biol. (0270-7306) 2007 Only protein-protein interactions imex curation kpcd_human Protein kinase C delta type nPKC-delta PRKCD Tyrosine-protein kinase PRKCD PKCD protein protein human Homo sapiens Human MAPFLRIAFNSYELGSLQAEDEANQPFCAVKMKEALSTERGKTLVQKKPTMYPEWKSTFDAHIYEGRVIQIVLMRAAEEPVSEVTVGVSVLAERCKKNNGKAEFWLDLQPQAKVLMSVQYFLEDVDCKQSMRSEDEAKFPTMNRRGAIKQAKIHYIKNHEFIATFFGQPTFCSVCKDFVWGLNKQGYKCRQCNAAIHKKCIDKIIGRCTGTAANSRDTIFQKERFNIDMPHRFKVHNYMSPTFCDHCGSLLWGLVKQGLKCEDCGMNVHHKCREKVANLCGINQKLLAEALNQVTQRASRRSDSASSEPVGIYQGFEKKTGVAGEDMQDNSGTYGKIWEGSSKCNINNFIFHKVLGKGSFGKVLLGELKGRGEYFAIKALKKDVVLIDDDVECTMVEKRVLTLAAENPFLTHLICTFQTKDHLFFVMEFLNGGDLMYHIQDKGRFELYRATFYAAEIMCGLQFLHSKGIIYRDLKLDNVLLDRDGHIKIADFGMCKENIFGESRASTFCGTPDYIAPEILQGLKYTFSVDWWSFGVLLYEMLIGQSPFHGDDEDELFESIRVDTPHYPRWITKESKDILEKLFEREPTKRLGVTGNIKIHPFFKTINWTLLEKRRLEPPFRPKVKSPRDYSNFDQEFLNEKARLSYSDKNLIDSMDQSAFAGFSFVNPKFEHLLED DIP protein Q05655 original sequence version: 92 DIP protein Q05655 original sequence version: 171 013F4314A2EE331A btf Similar to human Bcl-2-associated transcription factor 1 protein protein chlae Chlorocebus aethiops Cercopithecus aethiops Grivet Green monkey MGRSNSRSHSSRSKSRSQSSSRSRSRSHSRKKRYSSRSRSRTYSRSRSRDRMYSRDYRRDYRNNRGMRRPYGYRGRGRGYYQGGGGRYHRGGYRPVWNRRHSRSPRRGRSRSRSPKRRSVSSQRSRSRSRRSYRSSRSPRSSSSRSSSPYSKSPVSKRRGSQEKQTKKAEGEPQEESPLKSKSQEEPKDTFEHDPSESIDEFNKSSATSGDIWPGLSAYDNSPRSPHSPSPIATPPSQSSSCSDAPMLSTVHSAKNTPSQHSHSIQHSPERSGSGSVGNGSSRYSPSQNSPIHHIPSRRSPAKTIAPQNAPRDESRGRSSFYPDGGDQETAKTGKFLKRFTDEESRVFLLDRGNTRDKEASKEKGSEKGRAEGEWEDQEALDYFSDKESGKQKFNDSEGDDTEETEDYRQFRKSVLADQGKSFATASHRNTEEEGLKYKSKVSLKGNRESDGFREEKNYKLKETGYVVERPSTTKDKHKEEDKNSERITVKKETQSPEQVKSEKLKDLFDYSPPLHKNLDAREKSTFREESPLRIKMIASDSHRPEVKLKMAPVPLDDSNRPASLTKDRLLASTLVHSVKKEQEFRSIFDHIKLPQASKSTSESFIQHIVSLVHHVKEQYFKSAAMTLNERFTSYQKATEEHSTRQKSPEIHRRIDISPSTLRKHTRLAGEERVFKEENQKGDKKLRCDSADLRHDIDRRRKERSKERGDSKGSRESSGSRKQEKTPKDYKEYKSYKDDSKHKREQDHSRSSSSSASPSSPSSREEKESKKEREEEFKTHHEMKEYSGFAGVSRPRGTFFRIRGRGRARGVFAGTNTGPNNSNTTFQKRPKEEEWDPEYTPKSKKYFLHDDRDDGVDYWAKRGRGRGTFQRGRGRFNFKKSGSSPKWTHDKYQGDGIVEDEEETMENNEEKKDRRKEEKE Sequence stated is provisionally human, until a proper UniProt_AC is created. bclf1_human Bcl-2-associated transcription factor 1 BCLAF1 and THRAP3 family member 1 BCLAF1 BTF KIAA0164 protein protein human Homo sapiens Human MGRSNSRSHSSRSKSRSQSSSRSRSRSHSRKKRYSSRSRSRTYSRSRSRDRMYSRDYRRDYRNNRGMRRPYGYRGRGRGYYQGGGGRYHRGGYRPVWNRRHSRSPRRGRSRSRSPKRRSVSSQRSRSRSRRSYRSSRSPRSSSSRSSSPYSKSPVSKRRGSQEKQTKKAEGEPQEESPLKSKSQEEPKDTFEHDPSESIDEFNKSSATSGDIWPGLSAYDNSPRSPHSPSPIATPPSQSSSCSDAPMLSTVHSAKNTPSQHSHSIQHSPERSGSGSVGNGSSRYSPSQNSPIHHIPSRRSPAKTIAPQNAPRDESRGRSSFYPDGGDQETAKTGKFLKRFTDEESRVFLLDRGNTRDKEASKEKGSEKGRAEGEWEDQEALDYFSDKESGKQKFNDSEGDDTEETEDYRQFRKSVLADQGKSFATASHRNTEEEGLKYKSKVSLKGNRESDGFREEKNYKLKETGYVVERPSTTKDKHKEEDKNSERITVKKETQSPEQVKSEKLKDLFDYSPPLHKNLDAREKSTFREESPLRIKMIASDSHRPEVKLKMAPVPLDDSNRPASLTKDRLLASTLVHSVKKEQEFRSIFDHIKLPQASKSTSESFIQHIVSLVHHVKEQYFKSAAMTLNERFTSYQKATEEHSTRQKSPEIHRRIDISPSTLRKHTRLAGEERVFKEENQKGDKKLRCDSADLRHDIDRRRKERSKERGDSKGSRESSGSRKQEKTPKDYKEYKSYKDDSKHKREQDHSRSSSSSASPSSPSSREEKESKKEREEEFKTHHEMKEYSGFAGVSRPRGTFFRIRGRGRARGVFAGTNTGPNNSNTTFQKRPKEEEWDPEYTPKSKKYFLHDDRDDGVDYWAKRGRGRGTFQRGRGRFNFKKSGSSPKWTHDKYQGDGIVEDEEETMENNEEKKDRRKEEKE 8892B98E54F52C20 cpe-tp53 element CPE element of the TP53 promoter dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CAGGGGTTGATGGGATTGGGGTTTT p53_human_gene Cellular tumor antigen p53 (TP53) human gene gene gene human Homo sapiens Human cpe_tp53_element-btf 2 6 unspecified role unspecified role bait bait biotin tag biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role prey prey physical association physical association 4 bclaf1-cpe_tp53_element 1 5 unspecified role unspecified role bait bait 7 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 5a and 5d Treatment of the cells with ADR (doxorubicin) (CHEBI:28748) is required for the interaction to happen. The interaction can be disrupted by rottlerin (CHEBI:8899) treatment (inhibits PKC-delta activity). CHEBI:28748 increases binding of Q9NYF8 to ENSG00000141510 CHEBI:8899 decreases binding of Q9NYF8 to ENSG00000141510 Q9NYF8 increases expression at RNA level of ENSG00000141510 Q9NYF8 increases expression at protein level of ENSG00000141510 prkcd-cpe_tp53_elem 1 7 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 3 unspecified role unspecified role bait bait association association 5a and 5d Treatment of the cells with ADR (doxorubicin) (CHEBI:28748) is required for the interaction to happen. The interaction can be disrupted by rottlerin (CHEBI:8899) treatment (inhibits PKC-delta activity). CHEBI:28748 increases binding of Q05655 to ENSG00000141510 CHEBI:8899 decreases binding of Q05655 to ENSG00000141510 Q05655 increases expression at RNA level of ENSG00000141510 Q05655 increases expression at protein level of ENSG00000141510 prkcd-bclaf1 1 7 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 3 unspecified role unspecified role bait bait 5 unspecified role unspecified role prey prey association association 5b Treatment of the cells with ADR (doxorubicin) (CHEBI:28748) is required for the interaction to happen. bclaf1-prkcd 1 5 unspecified role unspecified role bait bait 3 unspecified role unspecified role prey prey 7 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 5c Treatment of the cells with ADR (doxorubicin) (CHEBI:28748) is required for the interaction to happen.