IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. Mol. Pharmacol. (0026-895X) 2005 imex curation Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease bart.staels@pasteur-lille.fr 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis bart.staels@pasteur-lille.fr Accepted 2014-DEC-02 by MGT Mol. Pharmacol. (0026-895X) 2005 Only protein-protein interactions imex curation For the third experiment (EMSA) there's 2 interactions where an unlabeled probe functions as a competitor; I wasn't sure what their experimental role would be, as the labeled probe is the bait so it's weird to have the unlabeled probe as prey; but otherwise there would be 2 baits? Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. Mol. Pharmacol. (0026-895X) 2005 imex curation Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease bart.staels@pasteur-lille.fr 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis bart.staels@pasteur-lille.fr Accepted 2014-DEC-02 by MGT Mol. Pharmacol. (0026-895X) 2005 Only protein-protein interactions imex curation For the third experiment (EMSA) there's 2 interactions where an unlabeled probe functions as a competitor; I wasn't sure what their experimental role would be, as the labeled probe is the bait so it's weird to have the unlabeled probe as prey; but otherwise there would be 2 baits? Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. Mol. Pharmacol. (0026-895X) 2005 imex curation Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease bart.staels@pasteur-lille.fr 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis bart.staels@pasteur-lille.fr Accepted 2014-DEC-02 by MGT Mol. Pharmacol. (0026-895X) 2005 Only protein-protein interactions imex curation For the third experiment (EMSA) there's 2 interactions where an unlabeled probe functions as a competitor; I wasn't sure what their experimental role would be, as the labeled probe is the bait so it's weird to have the unlabeled probe as prey; but otherwise there would be 2 baits? hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI 5F1309B89D95DCAF ud19_human_hnf4a-re_dna-probe Human UD19 (UGT1A9) gene promoter HNF4a response element DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TTTGCTCTGGGACAAATTCCAAAAAAAATTAG ud19_human_gene UDP-glucuronosyltransferase 1-9 (UD19) human gene gene gene human Homo sapiens Human apoc3_human_hnf4a-re_dna-probe Human APOC3 gene promoter HNF4a response element DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CAGCAGGTGACCTTTGCCCAGCGCCC ud19-hnf4a-4 1 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey in vitro In vitro physical association physical association Fig. 4a apoc3-hnf4a-2 1 4 unspecified role unspecified role prey prey in vitro In vitro 7 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 4a hnf4a-ud19-1 3 4 unspecified role unspecified role bait bait 6 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 5a P41235 increases expression at RNA level of ENSG00000241119 ud19-hnf4a-1 2 5 unspecified role unspecified role bait bait tttgctctgggacaaattccaa-to-tttgctctgggacgggccttga mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey in vitro In vitro physical association physical association Fig. 4b In vitro translated HNF4alpha was shown to bind the UD19 DNA probe in an EMSA supershift assay using anti-HNF4alpha antibody. ud19-hnf4a-2 2 7 competitor competitor competitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey in vitro In vitro association association Fig. 4c In vitro translated HNF4alpha was shown to bind the UD19 and APOC3 DNA probes in an EMSA supershift assay using anti-HNF4alpha antibody. ud19-hnf4a-3 2 5 competitor competitor competitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey in vitro In vitro association association Fig. 4c In vitro translated HNF4alpha was shown to bind the UD19 DNA probe in an EMSA supershift assay using anti-HNF4alpha antibody.