IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell (0092-8674) 2004 imex curation Vega RB., Matsuda K., Oh J., Barbosa AC., Yang X., Meadows E., McAnally J., Pomajzl C., Shelton JM., Richardson JA., Karsenty G., Olson EN. Chromatin - Epigenetic interactions resulting in chromatin modulation 5B eric.olson@utsouthwestern.edu Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Vega RB., Matsuda K., Oh J., Barbosa AC., Yang X., Meadows E., McAnally J., Pomajzl C., Shelton JM., Richardson JA., Karsenty G., Olson EN. Chromatin - Epigenetic interactions resulting in chromatin modulation 5B eric.olson@utsouthwestern.edu Annotation to indicate that this entry has been checked and accepted by a senior curator. Cell (0092-8674) 2004 Only protein-protein interactions imex curation Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell (0092-8674) 2004 imex curation Vega RB., Matsuda K., Oh J., Barbosa AC., Yang X., Meadows E., McAnally J., Pomajzl C., Shelton JM., Richardson JA., Karsenty G., Olson EN. Chromatin - Epigenetic interactions resulting in chromatin modulation 5B eric.olson@utsouthwestern.edu Only protein-protein interactions chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Vega RB., Matsuda K., Oh J., Barbosa AC., Yang X., Meadows E., McAnally J., Pomajzl C., Shelton JM., Richardson JA., Karsenty G., Olson EN. Chromatin - Epigenetic interactions resulting in chromatin modulation 5B eric.olson@utsouthwestern.edu Annotation to indicate that this entry has been checked and accepted by a senior curator. Cell (0092-8674) 2004 Only protein-protein interactions imex curation hdac4_mouse Histone deacetylase 4 Hdac4 protein protein mouse Mus musculus Mouse MSSQSHPDGLSGRDQPVELLNPARVNHMPSTVDVATALPLQVAPTAVPMDLRLDHQFSLPLEPALREQQLQQELLALKQKQQIQRQILIAEFQRQHEQLSRQHEAQLHEHIKQQQEMLAMKHQQELLEHQRKLERHRQEQELEKQHREQKLQQLKNKEKGKESAVASTEVKMKLQEFVLNKKKALAHRNLNHCISSDPRYWYGKTQHSSLDQSSPPQSGVSASYNHPVLGMYDAKDDFPLRKTASEPNLKLRSRLKQKVAERRSSPLLRRKDGPVATALKKRPLDVTDSACSSAPGSGPSSPNSSSGNVSTENGIAPTVPSAPAETSLAHRLVTREGSVAPLPLYTSPSLPNITLGLPATGPAAGAAGQQDAERLALPALQQRILFPGTHLTPYLSTSPLERDGAAAHNPLLQHMVLLEQPPTQTPLVTGLGALPLHSQSLVGADRVSPSIHKLRQHRPLGRTQSAPLPQNAQALQHLVIQQQHQQFLEKHKQQFQQQQLHLSKIISKPSEPPRQPESHPEETEEELREHQALLDEPYLDRLPGQKEPSLAGVQVKQEPIESEEEEAEATRETEPGQRPATEQELLFRQQALLLEQQRIHQLRNYQASMEAAGIPVSFGSHRPLSRAQSSPASATFPMSVQEPPTKPRFTTGLVYDTLMLKHQCTCGNTNSHPEHAGRIQSIWSRLQETGLRGKCECIRGRKATLEELQTVHSEAHTLLYGTNPLNRQKLDSSLTSVFVRLPCGGVGVDSDTIWNEVHSSGAARLAVGCVVELVFKVATGELKNGFAVVRPPGHHAEESTPMGFCYFNSVAVAAKLLQQRLNVSKILIVDWDVHHGNGTQQAFYNDPNVLYMSLHRYDDGNFFPGSGAPDEVGTGPGVGFNVNMAFTGGLEPPMGDAEYLAAFRTVVMPIANEFAPDVVLVSSGFDAVEGHPTPLGGYNLSAKCFGYLTKQLMGLAGGRLVLALEGGHDLTAICDASEACVSALLGNELEPLPEKVLHQRPNANAVHSMEKVMDIHSKYWRCLQRLSSTVGHSLIEAQKCEKEEAETVTAMASLSVGVKPAEKRSEEEPMEEEPPL DIP protein Q6NZM9 original sequence version: 71 DIP protein Q6NZM9 original sequence version: 84 A3CCC3CCCBB903A0 runx2_mouse Runt-related transcription factor 2 Runx2 Aml3 Cbfa1 Osf2 Pebp2a Core-binding factor subunit alpha-1 Acute myeloid leukemia 3 protein Oncogene AML-3 Polyomavirus enhancer-binding protein 2 alpha A subunit SL3-3 enhancer factor 1 alpha A subunit SL3/AKV core-binding factor alpha A subunit Osteoblast-specific transcription factor 2 protein protein mouse Mus musculus Mouse MLHSPHKQPQNHKCGANFLQEDCKKALAFKWLISAGHYQPPRPTESVSALTTVHAGIFKAASSIYNRGHKFYLEKKGGTMASNSLFSAVTPCQQSFFWDPSTSRRFSPPSSSLQPGKMSDVSPVVAAQQQQQQQQQQQQQQQQQQQQQQQQQQQQQEAAAAAAAAAAAAAAAAAAVPRLRPPHDNRTMVEIIADHPAELVRTDSPNFLCSVLPSHWRCNKTLPVAFKVVALGEVPDGTVVTVMAGNDENYSAELRNASAVMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKVTVDGPREPRRHRQKLDDSKPSLFSDRLSDLGRIPHPSMRVGVPPQNPRPSLNSAPSPFNPQGQSQITDPRQAQSSPPWSYDQSYPSYLSQMTSPSIHSTTPLSSTRGTGLPAITDVPRRISDDDTATSDFCLWPSSLSKKSQAGASELGPFSDPRQFPSISSLTESRFSNPRMHYPATFTYTPPVTSGMSLGMSATTHYHTYLPPPYPGSSQSQSGPFQTSSTPYLYYGTSSASYQFPMVPGGDRSPSRMVPPCTTTSNGSTLLNPNLPNQNDGVDADGSHSSSPTVLNSSGRMDESVWRPY DIP protein Q08775 original sequence version: 136 DIP protein Q08775 original sequence version: 135 E87A4497ED19EE0E ose2 Osteocalcin dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid in vitro In vitro AGCTGCAATCACCAACCACAGCA region covered by sequence was 852-874 A3885D8023E82ABD hdac4-runx2 2 4 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined runt domain required to bind necessary binding region required to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain 3 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Q6NZM9; Q08775 transfection hdac4-runx2-1 2 4 unspecified role unspecified role prey prey 3 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined mef2 binding region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain physical association physical association Q6NZM9; Q08775 transfection ose2-hdac4 1 3 unspecified role unspecified role neutral component neutral component in vitro In vitro 4 unspecified role unspecified role neutral component neutral component region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role neutral component neutral component region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain association association