IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Cancer Cell (1535-6108) 2012 imex curation Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis Cancer - Interactions investigated in the context of cancer SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu 19-Sept-2012: Contacted by IntAct-Help. Only protein-protein interactions human-pbl-bcll Homo sapiens pbl-bcll: PBLs from human B cell Chronic Lymphocytic Leukaemia patients peripheral_blood_lymphocyte-bcll pbl-bcll: PBLs from B cell Chronic Lymphocytic Leukaemia patients B cell population was >95% CD19+ and >90% CD5+. ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Accepted 2012-JUL-19 by PPORRAS 19-Sept-2012: Contacted by IntAct-Help. Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Cancer Cell (1535-6108) 2012 imex curation Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis Cancer - Interactions investigated in the context of cancer SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu 19-Sept-2012: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Accepted 2012-JUL-19 by PPORRAS 19-Sept-2012: Contacted by IntAct-Help. Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Cancer Cell (1535-6108) 2012 imex curation Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis Cancer - Interactions investigated in the context of cancer SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu 19-Sept-2012: Contacted by IntAct-Help. Only protein-protein interactions human-697 Homo sapiens 697 Dexamethasone-resistant human Pre-B leukemia 697 cell line anti bait coip anti bait coimmunoprecipitation anti bait coip anti tag western anti tag western blot anti tag western Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Accepted 2012-JUL-19 by PPORRAS 19-Sept-2012: Contacted by IntAct-Help. Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Cancer Cell (1535-6108) 2012 imex curation Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis Cancer - Interactions investigated in the context of cancer SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu 19-Sept-2012: Contacted by IntAct-Help. Only protein-protein interactions human-pbl-bcll Homo sapiens pbl-bcll: PBLs from human B cell Chronic Lymphocytic Leukaemia patients peripheral_blood_lymphocyte-bcll pbl-bcll: PBLs from B cell Chronic Lymphocytic Leukaemia patients B cell population was >95% CD19+ and >90% CD5+. anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Accepted 2012-JUL-19 by PPORRAS 19-Sept-2012: Contacted by IntAct-Help. Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Cancer Cell (1535-6108) 2012 imex curation Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis Cancer - Interactions investigated in the context of cancer SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu 19-Sept-2012: Contacted by IntAct-Help. Only protein-protein interactions human-697 Homo sapiens 697 Dexamethasone-resistant human Pre-B leukemia 697 cell line anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. Identity and reason for adding "alpha-Fc" not given in paper and no reply from author - so ignored. (may be Fc region of IgA isotype - but this would seem unlikely....?) The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Accepted 2012-JUL-19 by PPORRAS 19-Sept-2012: Contacted by IntAct-Help. Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation pk3cg_human Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit gamma isoform PIK3CG p120-PI3K Phosphoinositide-3-kinase catalytic gamma polypeptide Serine/threonine protein kinase PIK3CG Phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit gamma protein protein human Homo sapiens Human MELENYKQPVVLREDNCRRRRRMKPRSAAASLSSMELIPIEFVLPTSQRKCKSPETALLHVAGHGNVEQMKAQVWLRALETSVAADFYHRLGPHHFLLLYQKKGQWYEIYDKYQVVQTLDCLRYWKATHRSPGQIHLVQRHPPSEESQAFQRQLTALIGYDVTDVSNVHDDELEFTRRGLVTPRMAEVASRDPKLYAMHPWVTSKPLPEYLWKKIANNCIFIVIHRSTTSQTIKVSPDDTPGAILQSFFTKMAKKKSLMDIPESQSEQDFVLRVCGRDEYLVGETPIKNFQWVRHCLKNGEEIHVVLDTPPDPALDEVRKEEWPLVDDCTGVTGYHEQLTIHGKDHESVFTVSLWDCDRKFRVKIRGIDIPVLPRNTDLTVFVEANIQHGQQVLCQRRTSPKPFTEEVLWNVWLEFSIKIKDLPKGALLNLQIYCGKAPALSSKASAESPSSESKGKVQLLYYVNLLLIDHRFLLRRGEYVLHMWQISGKGEDQGSFNADKLTSATNPDKENSMSISILLDNYCHPIALPKHQPTPDPEGDRVRAEMPNQLRKQLEAIIATDPLNPLTAEDKELLWHFRYESLKHPKAYPKLFSSVKWGQQEIVAKTYQLLARREVWDQSALDVGLTMQLLDCNFSDENVRAIAVQKLESLEDDDVLHYLLQLVQAVKFEPYHDSALARFLLKRGLRNKRIGHFLFWFLRSEIAQSRHYQQRFAVILEAYLRGCGTAMLHDFTQQVQVIEMLQKVTLDIKSLSAEKYDVSSQVISQLKQKLENLQNSQLPESFRVPYDPGLKAGALAIEKCKVMASKKKPLWLEFKCADPTALSNETIGIIFKHGDDLRQDMLILQILRIMESIWETESLDLCLLPYGCISTGDKIGMIEIVKDATTIAKIQQSTVGNTGAFKDEVLNHWLKEKSPTEEKFQAAVERFVYSCAGYCVATFVLGIGDRHNDNIMITETGNLFHIDFGHILGNYKSFLGINKERVPFVLTPDFLFVMGTSGKKTSPHFQKFQDICVKAYLALRHHTNLLIILFSMMLMTGMPQLTSKEDIEYIRDALTVGKNEEDAKKYFLDQIEVCRDKGWTVQFNWFLHLVLGIKQGEKHSA DIP protein P48736 original sequence version: 103 DIP protein P48736 original sequence version: 137 EF2B1A0E1CBEF406 foxo3_human Forkhead box protein O3 FOXO3 FKHRL1 FOXO3A Forkhead in rhabdomyosarcoma-like 1 AF6q21 protein protein protein human Homo sapiens Human MAEAPASPAPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEEDDEDDEDGGGRAGSAMAIGGGGGSGTLGSGLLLEDSARVLAPGGQDPGSGPATAAGGLSGGTQALLQPQQPLPPPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQTAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPIMASTELDEVQDDDAPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLTENLMDDLLDNITLPPSQPSPTGGLMQRSSSFPYTTKGSGLGSPTSSFNSTVFGPSSLNSLRQSPMQTIQENKPATFSSMSHYGNQTLQDLLTSDSLSHSDVMMTQSDPLMSQASTAVSAQNSRRNVMLRNDPMMSFAAQPNQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSESSSLGSAKHQQQSPVSQSMQTLSDSLSGSSLYSTSANLPVMGHEKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG E5B4E830665A9982 DIP protein O43524 original sequence version: 82 E5B4E830665A9982 lyn_human Tyrosine-protein kinase Lyn JTK8 Lck/Yes-related novel protein tyrosine kinase V-yes-1 Yamaguchi sarcoma viral related oncogene homolog p53Lyn p56Lyn LYN protein protein human Homo sapiens Human MGCIKSKGKDSLSDDGVDLKTQPVRNTERTIYVRDPTSNKQQRPVPESQLLPGQRFQTKDPEEQGDIVVALYPYDGIHPDDLSFKKGEKMKVLEEHGEWWKAKSLLTKKEGFIPSNYVAKLNTLETEEWFFKDITRKDAERQLLAPGNSAGAFLIRESETLKGSFSLSVRDFDPVHGDVIKHYKIRSLDNGGYYISPRITFPCISDMIKHYQKQADGLCRRLEKACISPKPQKPWDKDAWEIPRESIKLVKRLGAGQFGEVWMGYYNNSTKVAVKTLKPGTMSVQAFLEEANLMKTLQHDKLVRLYAVVTREEPIYIITEYMAKGSLLDFLKSDEGGKVLLPKLIDFSAQIAEGMAYIERKNYIHRDLRAANVLVSESLMCKIADFGLARVIEDNEYTAREGAKFPIKWTAPEAINFGCFTIKSDVWSFGILLYEIVTYGKIPYPGRTNADVMTALSQGYRMPRVENCPDELYDIMKMCWKEKAEERPTFDYLQSVLDDFYTATEGQYQQQP DIP protein P07948 original sequence version: 141 408D3D461204E378 pk3cd_human Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform PIK3CD Phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit delta protein protein human Homo sapiens Human MPPGVDCPMEFWTKEENQSVVVDFLLPTGVYLNFPVSRNANLSTIKQLLWHRAQYEPLFHMLSGPEAYVFTCINQTAEQQELEDEQRRLCDVQPFLPVLRLVAREGDRVKKLINSQISLLIGKGLHEFDSLCDPEVNDFRAKMCQFCEEAAARRQQLGWEAWLQYSFPLQLEPSAQTWGPGTLRLPNRALLVNVKFEGSEESFTFQVSTKDVPLALMACALRKKATVFRQPLVEQPEDYTLQVNGRHEYLYGSYPLCQFQYICSCLHSGLTPHLTMVHSSSILAMRDEQSNPAPQVQKPRAKPPPIPAKKPSSVSLWSLEQPFRIELIQGSKVNADERMKLVVQAGLFHGNEMLCKTVSSSEVSVCSEPVWKQRLEFDINICDLPRMARLCFALYAVIEKAKKARSTKKKSKKADCPIAWANLMLFDYKDQLKTGERCLYMWPSVPDEKGELLNPTGTVRSNPNTDSAAALLICLPEVAPHPVYYPALEKILELGRHSECVHVTEEEQLQLREILERRGSGELYEHEKDLVWKLRHEVQEHFPEALARLLLVTKWNKHEDVAQMLYLLCSWPELPVLSALELLDFSFPDCHVGSFAIKSLRKLTDDELFQYLLQLVQVLKYESYLDCELTKFLLDRALANRKIGHFLFWHLRSEMHVPSVALRFGLILEAYCRGSTHHMKVLMKQGEALSKLKALNDFVKLSSQKTPKPQTKELMHLCMRQEAYLEALSHLQSPLDPSTLLAEVCVEQCTFMDSKMKPLWIMYSNEEAGSGGSVGIIFKNGDDLRQDMLTLQMIQLMDVLWKQEGLDLRMTPYGCLPTGDRTGLIEVVLRSDTIANIQLNKSNMAATAAFNKDALLNWLKSKNPGEALDRAIEEFTLSCAGYCVATYVLGIGDRHSDNIMIRESGQLFHIDFGHFLGNFKTKFGINRERVPFILTYDFVHVIQQGKTNNSEKFERFRGYCERAYTILRRHGLLFLHLFALMRAAGLPELSCSKDIQYLKDSLALGKTEEEALKHFRVKFNEALRESWKTKVNWLAHNVSKDNRQ A38B5D1A1081A3D0 A38B5D1A1081A3D0 ksyk_human Tyrosine-protein kinase SYK SYK Spleen tyrosine kinase p72-Syk protein protein human Homo sapiens Human MASSGMADSANHLPFFFGNITREEAEDYLVQGGMSDGLYLLRQSRNYLGGFALSVAHGRKAHHYTIERELNGTYAIAGGRTHASPADLCHYHSQESDGLVCLLKKPFNRPQGVQPKTGPFEDLKENLIREYVKQTWNLQGQALEQAIISQKPQLEKLIATTAHEKMPWFHGKISREESEQIVLIGSKTNGKFLIRARDNNGSYALCLLHEGKVLHYRIDKDKTGKLSIPEGKKFDTLWQLVEHYSYKADGLLRVLTVPCQKIGTQGNVNFGGRPQLPGSHPATWSAGGIISRIKSYSFPKPGHRKSSPAQGNRQESTVSFNPYEPELAPWAADKGPQREALPMDTEVYESPYADPEEIRPKEVYLDRKLLTLEDKELGSGNFGTVKKGYYQMKKVVKTVAVKILKNEANDPALKDELLAEANVMQQLDNPYIVRMIGICEAESWMLVMEMAELGPLNKYLQQNRHVKDKNIIELVHQVSMGMKYLEESNFVHRDLAARNVLLVTQHYAKISDFGLSKALRADENYYKAQTHGKWPVKWYAPECINYYKFSSKSDVWSFGVLMWEAFSYGQKPYRGMKGSEVTAMLEKGERMGCPAGCPREMYDLMNLCWTYDVENRPGFAAVELRLRNYYYDVVN DIP protein P43405 original sequence version: 146 EAA6BDE65881FC68 bim_human_promoter_probe human BIM promoter probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CAGAGTTACTCCGGTAAACACGCCAGGGAC cd37_human Leukocyte antigen CD37 CD37 TSPAN26 Tetraspanin-26 protein protein human Homo sapiens Human MSAQESCLSLIKYFLFVFNLFFFVLGSLIFCFGIWILIDKTSFVSFVGLAFVPLQIWSKVLAISGIFTMGIALLGCVGALKELRCLLGLYFGMLLLLFATQITLGILISTQRAQLERSLRDVVEKTIQKYGTNPEETAAEESWDYVQFQLRCCGWHYPQDWFQVLILRGNGSEAHRVPCSCYNLSATNDSTILDKVILPQLSRLGHLARSRHSADICAVPAESHIYREGCAQGLQKWLHNNLISIVGICLGVGLLELGFMTLSIFLCRNLDHVYNRLARYR 4342C5FB4479FDC8 bim_human_gene Human Bim gene gene gene human Homo sapiens Human syk_human Lysine--tRNA ligase KARS1 KARS KIAA0070 Lysyl-tRNA synthetase protein protein human Homo sapiens Human MAAVQAAEVKVDGSEPKLSKNELKRRLKAEKKVAEKEAKQKELSEKQLSQATAAATNHTTDNGVGPEEESVDPNQYYKIRSQAIHQLKVNGEDPYPHKFHVDISLTDFIQKYSHLQPGDHLTDITLKVAGRIHAKRASGGKLIFYDLRGEGVKLQVMANSRNYKSEEEFIHINNKLRRGDIIGVQGNPGKTKKGELSIIPYEITLLSPCLHMLPHLHFGLKDKETRYRQRYLDLILNDFVRQKFIIRSKIITYIRSFLDELGFLEIETPMMNIIPGGAVAKPFITYHNELDMNLYMRIAPELYHKMLVVGGIDRVYEIGRQFRNEGIDLTHNPEFTTCEFYMAYADYHDLMEITEKMVSGMVKHITGSYKVTYHPDGPEGQAYDVDFTPPFRRINMVEELEKALGMKLPETNLFETEETRKILDDICVAKAVECPPPRTTARLLDKLVGEFLEVTCINPTFICDHPQIMSPLAKWHRSKEGLTERFELFVMKKEICNAYTELNDPMRQRQLFEEQAKAKAAGDDEAMFIDENFCTALEYGLPPTAGWGMGIDRVAMFLTDSNNIKEVLLFPAMKPEDKKENVATTDTLESTTVGTSV DIP protein Q15046 original sequence version: 69 DIP protein Q15046 original sequence version: 116 DIP protein Q15046-1 original sequence version: 124 DIP protein Q15046-1 original sequence version: 129 DIP protein Q15046 original sequence version: 129 E7770953332D905D ptn6_human Tyrosine-protein phosphatase non-receptor type 6 PTPN6 HCP Protein-tyrosine phosphatase 1C Hematopoietic cell protein-tyrosine phosphatase SH-PTP1 Protein-tyrosine phosphatase SHP-1 PTP1C protein protein human Homo sapiens Human MVRWFHRDLSGLDAETLLKGRGVHGSFLARPSRKNQGDFSLSVRVGDQVTHIRIQNSGDFYDLYGGEKFATLTELVEYYTQQQGVLQDRDGTIIHLKYPLNCSDPTSERWYHGHMSGGQAETLLQAKGEPWTFLVRESLSQPGDFVLSVLSDQPKAGPGSPLRVTHIKVMCEGGRYTVGGLETFDSLTDLVEHFKKTGIEEASGAFVYLRQPYYATRVNAADIENRVLELNKKQESEDTAKAGFWEEFESLQKQEVKNLHQRLEGQRPENKGKNRYKNILPFDHSRVILQGRDSNIPGSDYINANYIKNQLLGPDENAKTYIASQGCLEATVNDFWQMAWQENSRVIVMTTREVEKGRNKCVPYWPEVGMQRAYGPYSVTNCGEHDTTEYKLRTLQVSPLDNGDLIREIWHYQYLSWPDHGVPSEPGGVLSFLDQINQRQESLPHAGPIIVHCSAGIGRTGTIIVIDMLMENISTKGLDCDIDIQKTIQMVRAQRSGMVQTEAQYKFIYVAIAQFIETTKKKLEVLQSQKGQESEYGNITYPPAMKNAHAKASRTSSKHKEDVYENLHTKNKREEKVKKQRSADKEKSKGSLKRK DIP protein P29350 original sequence version: 183 DIP protein P29350 original sequence version: 139 DIP protein P29350-1 original sequence version: 139 4D7736C21D3542D2 ptpn6-cd37 4 12 unspecified role unspecified role prey prey 15 unspecified role unspecified role bait bait physical association physical association Fig 1F, S1H. CD37 was tyrosine phosphorylated and associated with both SHP1 and LYN. This reaction was only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) -SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. lyn-cd37 4 12 unspecified role unspecified role prey prey 8 unspecified role unspecified role bait bait physical association physical association Fig 1F, S1H. CD37 was tyrosine phosphorylated and associated with both SHP1 and LYN. This reaction was only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) -SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. lyn-cd37-1 5 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range 8 unspecified role unspecified role bait bait physical association physical association Fig 3E CD37 associates with LYN, SHP1, and SYK upon ligation with SMIP-016. SMIP-016(TM)+alphaFc (anti-human IgG). syk-cd37 5 10 unspecified role unspecified role bait bait 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range physical association physical association Fig 3E CD37 associates with LYN, SHP1, and SYK upon ligation with SMIP-016. SMIP-016(TM)+alphaFc (anti-human IgG). shp1-cd37 5 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range 15 unspecified role unspecified role bait bait physical association physical association Fig 3E CD37 associates with LYN, SHP1, and SYK upon ligation with SMIP-016. SMIP-016(TM)+alphaFc (anti-human IgG). cd37-lyn 5 8 unspecified role unspecified role prey prey 12 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range P11049:p.Tyr13Phe mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain Y F Wed May 02 18:37:32 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'tyr13phe' Tue Jun 30 17:00:11 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr13Phe' 10 unspecified role unspecified role prey prey association association Fig 3F CD37 associates with LYN, SHP1, and SYK upon ligation with SMIP-016. SMIP-016(TM)+alphaFc (anti-human IgG). these muatations are described in the TEXT after this Fig and in Fig4A. I have attempted to read off the numbers of the deleted/mutated regions from this Fig as naturally, this info is not given elsewhere... syk-cd37-1 3 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range 10 unspecified role unspecified role bait bait physical association physical association Fig 4G SMIP-016(TM)+alphaFc (anti-human IgG). lyn-cd37 3 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range P11049:p.Tyr13Phe mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain Y F Wed May 02 17:40:38 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'tyr13phe' Tue Jun 30 18:42:41 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr13Phe' 8 unspecified role unspecified role bait bait physical association physical association Fig 4G, 4I SMIP-016(TM)+alphaFc (anti-human IgG). shp1-cd37-2 3 15 unspecified role unspecified role bait bait 12 unspecified role unspecified role prey prey P11049:p.Tyr13Phe mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain Y F Wed May 02 17:13:37 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'tyr13phe' Tue Jun 30 16:21:42 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr13Phe' n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range physical association physical association Fig 4G,4I, 4J SMIP-016(TM)+alphaFc (anti-human IgG). Herbimycin lyn-cd37-2 3 12 unspecified role unspecified role prey prey region required to bind necessary binding region required to bind range range range range n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range 9 unspecified role unspecified role bait bait physical association physical association Fig 4K SMIP-016(TM)+alphaFc (anti-human IgG). pik3cd-cd37 3 6 unspecified role unspecified role bait bait 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range physical association physical association Fig 4N SMIP-016(TM)+alphaFc (anti-human IgG). bim-foxo3 2 7 unspecified role unspecified role prey prey human-pbl-bcll Homo sapiens pbl-bcll: PBLs from human B cell Chronic Lymphocytic Leukaemia patients peripheral_blood_lymphocyte-bcll pbl-bcll: PBLs from B cell Chronic Lymphocytic Leukaemia patients B cell population was >95% CD19+ and >90% CD5+. 11 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig 6G SMIP-016+αFc-treated Nuclear extracts from cells were used. foxo3-bim 1 7 unspecified role unspecified role bait bait 13 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 6H SMIP-016+alpha-Fc-treated cd37-kars-1 4 15 unspecified role unspecified role prey prey 12 unspecified role unspecified role bait bait 8 unspecified role unspecified role prey prey 14 unspecified role unspecified role prey prey association association Fig S1H. CD37 was tyrosine phosphorylated and associated with both SHP1 and LYN. This reaction was only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) -SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. lyn-ptpn6 5 15 unspecified role unspecified role prey prey 8 unspecified role unspecified role bait bait physical association physical association Fig S2B Lack of the (CD37) C-t region did not prevent co-association of LYN and SHP1 (Figure S2B). However the replacement of Tyr13 with Phe notably reduced SMIP-016-induced CD37 phosphorylation and prevented association of SHP1 and LYN. SMIP-016(TM)+alphaFc (anti-human IgG). these muatations are described in the TEXT after this Fig and in Fig4A. I have attempted to read off the numbers of the deleted/mutated regions from this Fig as naturally, this info is not given elsewhere...