IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Orientation of the transcription preinitiation complex in archaea. Orientation of the transcription preinitiation complex in archaea. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 1999 imex curation Bell SD., Kosa PL., Sigler PB., Jackson SP. Archaea - Interaction dataset based on Archaea proteins orchard Only protein-protein interactions pyrwo Pyrococcus woesei crosslink cross-linking study crosslink weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Bell SD., Kosa PL., Sigler PB., Jackson SP. Archaea - Interaction dataset based on Archaea proteins Accepted 2010-APR-8 by ORCHARD. Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 1999 orchard Only protein-protein interactions imex curation p_woesei_x_up Pyrococcus woesei nucleotide from TATA box ds dna double stranded deoxyribonucleic acid ds DNA ds dna pyrwo Pyrococcus woesei AGTAAGTTAAATACTTATAT B4E29193D385FD76 tf2b_pyrwo Transcription initiation factor IIB tfb protein protein pyrwo Pyrococcus woesei MNKQKVCPACESAELIYDPERGEIVCAKCGYVIEENIIDMGPEWRAFDASQRERRSRTGAPESILLHDKGLSTEIGIDRSLSGLMREKMYRLRKWQSRLRVSDAAERNLAFALSELDRITAQLKLPRHVEEEAARLYREAVRKGLIRGRSIESVMAACVYAACRLLKVPRTLDEIADIARVDKKEIGRSYRFIARNLNLTPKKLFVKPTDYVNKFADELGLSEKVRRRAIEILDEAYKRGLTSGKSPAGLVAAALYIASLLEGEKRTQREVAEVARVTEVTVRNRYKELVEKLKIKVPIA 476D7CA32B2ED4C1 tbp_pyrwo TATA-box-binding protein tbp TATA-box factor TATA sequence-binding protein Box A-binding protein protein protein pyrwo Pyrococcus woesei MVDMSKVKLRIENIVASVDLFAQLDLEKVLDLCPNSKYNPEEFPGIICHLDDPKVALLIFSSGKLVVTGAKSVQDIERAVAKLAQKLKSIGVKFKRAPQIDVQNMVFSGDIGREFNLDVVALTLPNCEYEPEQFPGVIYRVKEPKSVILLFSSGKIVCSGAKSEADAWEAVRKLLRELDKYGLLEEEEEEL B371491BF9282972 tfb-tbp 1 3 unspecified role unspecified role neutral component neutral component sulsf Sulfolobus solfataricus 4 unspecified role unspecified role neutral component neutral component sulsf Sulfolobus solfataricus 2 unspecified role unspecified role neutral component neutral component physical association physical association Fig. 5 e