IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. EMBO J. (0261-4189) 2003 imex curation Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis Met + MAT - for the nuclease assays it is stated:- "Labeled substrate (100 fmol) was incubated with 0.2 µl of the indicated protein (synthesized using Promega TNT-coupled reticulocyte lysate system). " so crn-1 and cps-6 have been added as "in vitro" - and presumably taggless.... 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu 26-Jun-2011: Contacted by JYOTI. orchard Only protein-protein interactions in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis Met + MAT - for the nuclease assays it is stated:- "Labeled substrate (100 fmol) was incubated with 0.2 µl of the indicated protein (synthesized using Promega TNT-coupled reticulocyte lysate system). " so crn-1 and cps-6 have been added as "in vitro" - and presumably taggless.... 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu Accepted 2011-JUN-13 by ORCHARD 26-Jun-2011: Contacted by JYOTI. EMBO J. (0261-4189) 2003 orchard Only protein-protein interactions imex curation CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. EMBO J. (0261-4189) 2003 imex curation Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis Met + MAT - for the nuclease assays it is stated:- "Labeled substrate (100 fmol) was incubated with 0.2 µl of the indicated protein (synthesized using Promega TNT-coupled reticulocyte lysate system). " so crn-1 and cps-6 have been added as "in vitro" - and presumably taggless.... 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu 26-Jun-2011: Contacted by JYOTI. orchard Only protein-protein interactions in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis Met + MAT - for the nuclease assays it is stated:- "Labeled substrate (100 fmol) was incubated with 0.2 µl of the indicated protein (synthesized using Promega TNT-coupled reticulocyte lysate system). " so crn-1 and cps-6 have been added as "in vitro" - and presumably taggless.... 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu Accepted 2011-JUN-13 by ORCHARD 26-Jun-2011: Contacted by JYOTI. EMBO J. (0261-4189) 2003 orchard Only protein-protein interactions imex curation CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. EMBO J. (0261-4189) 2003 imex curation Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis Met + MAT - for the nuclease assays it is stated:- "Labeled substrate (100 fmol) was incubated with 0.2 µl of the indicated protein (synthesized using Promega TNT-coupled reticulocyte lysate system). " so crn-1 and cps-6 have been added as "in vitro" - and presumably taggless.... 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu 26-Jun-2011: Contacted by JYOTI. orchard Only protein-protein interactions in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis Met + MAT - for the nuclease assays it is stated:- "Labeled substrate (100 fmol) was incubated with 0.2 µl of the indicated protein (synthesized using Promega TNT-coupled reticulocyte lysate system). " so crn-1 and cps-6 have been added as "in vitro" - and presumably taggless.... 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu Accepted 2011-JUN-13 by ORCHARD 26-Jun-2011: Contacted by JYOTI. EMBO J. (0261-4189) 2003 orchard Only protein-protein interactions imex curation CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. EMBO J. (0261-4189) 2003 imex curation Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis Met + MAT - for the nuclease assays it is stated:- "Labeled substrate (100 fmol) was incubated with 0.2 µl of the indicated protein (synthesized using Promega TNT-coupled reticulocyte lysate system). " so crn-1 and cps-6 have been added as "in vitro" - and presumably taggless.... 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu 26-Jun-2011: Contacted by JYOTI. orchard Only protein-protein interactions in vitro In vitro pull down pull down weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis Met + MAT - for the nuclease assays it is stated:- "Labeled substrate (100 fmol) was incubated with 0.2 µl of the indicated protein (synthesized using Promega TNT-coupled reticulocyte lysate system). " so crn-1 and cps-6 have been added as "in vitro" - and presumably taggless.... 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu Accepted 2011-JUN-13 by ORCHARD 26-Jun-2011: Contacted by JYOTI. EMBO J. (0261-4189) 2003 orchard Only protein-protein interactions imex curation cacgttgactaccgtc 5′-CACGTTGACTACCGTC-3′ dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CACGTTGACTACCGTC fen1_caeel Flap endonuclease 1 Y47G6A.8 crn-1 Cell death-related nuclease 1 Flap structure-specific endonuclease 1 protein protein caeel Caenorhabditis elegans MGIKGLSQVIADNAPSAIKVNEMKAFFGRTVAIDASMCLYQFLIAVRQDGSQLQSEDGETTSHLMGMLNRTVRMFENGVKPVYVFDGKPPDMKGGELEKRSERRAEAEKALTEAKEKGDVKEAEKFERRLVKVTKQQNDEAKRLLGLMGIPVVEAPCEAEAQCAHLVKAGKVFGTVTEDMDALTFGSTVLLRHFLAPVAKKIPIKEFNLSLALEEMKLSVEEFIDLCILLGCDYCGTIRGVGPKKAVELIRQHKNIETILENIDQNKYPPPEDWPYKRARELFLNPEVTKPEEVELTWKEADVEGVIQFLCGEKNFNEERIRNALAKLKTSRKSGTQGRIDSFFGNSTKVTCVTAATKRKAEEAEKAKKGAKKGGPPKKRAK FDFE0BA0707321EB gatgtcaagcagtcctaactttgaggcagtcc (5′- GATGTCAAGCAGTCCTAACTTTGAGGCAGAGTCC-3′) dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GATGTCAAGCAGTCCTAACTTTGAGGCAGAGTCC cttgaggcagagtcc 5′-CTTGAGGCAGAGTCC-3′ dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CTTGAGGCAGAGTCC ggactctgcctcaagacggtagtcaacgtg 5′- GGACTCTGCCTCAAGACGGTAGTCAACGTG-3′ dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GGACTCTGCCTCAAGACGGTAGTCAACGTG ggactctgcctcaagacggtagtcaacgtggtgtg 5′-GGACTCTGCCTCAAGACGGTAGTCAACGTGGTGTG-3′ dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GGACTCTGCCTCAAGACGGTAGTCAACGTGGTGTG cacaccacgttgactaccgt_minus_1-4_nucleotides_at_3'_end 5′-CACACCACGTTGACTACCGT-3′ minus_1-4_nucleotides at 3' end dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CACACCACGTTGACTACCGT nucg_caeel Endonuclease G, mitochondrial Ced-3 protease suppressor 6 cps-6 C41D11.8 protein protein caeel Caenorhabditis elegans MIGKVAGTAAIAGISFLAGKYSNDDLPIFRNVQSATNVPMNQIQVSEPMTVKPASLNADAMGPSRSAEIMKHGYPGFTNVRTYEDFVLSYDYKTRTAHWVCEHLTPERLKHAEGVDRKLCEFKPDITFPQKFLSQNTDYKCSGFDRGHLAAAGNHRKSQLAVDQTFYLSNMSPQVGRGFNRDKWNDLEMHCRRVAKKMINSYIITGPLYLPKLEGDGKKYIKYQVIGDNNVAVPTHFFKVALFEVTPGKFELESYILPNAVIEDTVEISKFHVPLDAVERSAGLEIFARLDPKSIVKENGAKKGGLLW 9BAE5813E178CEB3 crn_1-cps_6 4 6 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 12 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 16 19 direct interaction direct interaction Fig 2A cacaccacgttgac-cps_6 1 8 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 12 stimulator stimulator ancillary ancillary in vitro In vitro 10 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 11 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 6 enzyme enzyme neutral component neutral component Q9N3T2:p.Glu160Asp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain E D Wed May 02 16:23:47 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'glu160asp' Tue Jun 30 19:41:40 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Glu160Asp' Q9N3T2:p.Asp233_Tyr234delinsAlaAla mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain DY AA Thu Jul 07 12:16:29 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was asp233ala-tyr234ala Fri Jul 22 11:03:03 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'asp233ala,tyr234ala' Wed May 02 17:58:01 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp_tyr233-234ala_ala' Tue Jun 30 16:07:11 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp233_Tyr234delinsAlaAla' in vitro In vitro physical association physical association Fig 2C, 3C. cacgttgactaccg-cps_6 2 5 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 9 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 7 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 6 enzyme enzyme neutral component neutral component Q9N3T2:p.Glu160Asp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain E D Wed May 02 19:07:17 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'glu160asp' Tue Jun 30 17:33:54 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Glu160Asp' Q9N3T2:p.Asp233_Tyr234delinsAlaAla mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain DY AA Thu Jul 07 12:07:06 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was asp233ala-tyr234ala Fri Jul 22 11:08:07 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'asp233ala,tyr234ala' Wed May 02 15:14:17 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp_tyr233-234ala_ala' Tue Jun 30 18:30:46 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp233_Tyr234delinsAlaAla' in vitro In vitro physical association physical association Fig 2B cacaccacgttg-cps_6-1 3 8 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 12 stimulator stimulator ancillary ancillary in vitro In vitro 6 enzyme enzyme neutral component neutral component Q9N3T2:p.Glu160Asp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain E D Wed May 02 15:49:08 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'glu160asp' Tue Jun 30 17:17:16 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Glu160Asp' Q9N3T2:p.Asp233_Tyr234delinsAlaAla mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain DY AA Thu Jul 07 12:16:48 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was asp233ala-tyr234ala Fri Jul 22 11:03:18 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'asp233ala,tyr234ala' Wed May 02 19:58:59 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp_tyr233-234ala_ala' Tue Jun 30 18:44:30 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp233_Tyr234delinsAlaAla' in vitro In vitro 10 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 11 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig 2C, 3D. cacaccacgttg-cps_6-2 3 10 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 8 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 6 enzyme enzyme neutral component neutral component Q9N3T2:p.Asp233_Tyr234delinsAlaAla mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain DY AA Thu Jul 07 12:16:24 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was asp233ala-tyr234ala Fri Jul 22 10:50:15 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'asp233ala,tyr234ala' Wed May 02 19:12:29 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp_tyr233-234ala_ala' Tue Jun 30 19:00:01 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp233_Tyr234delinsAlaAla' Q9N3T2:p.Glu160Asp mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain E D Wed May 02 15:42:47 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'glu160asp' Tue Jun 30 19:21:07 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Glu160Asp' in vitro In vitro 12 stimulator stimulator ancillary ancillary in vitro In vitro phosphotransfer phosphotransfer reaction phosphotransfer Fig 2D, 3D.