IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ mehaffey-2001-2 in vitro In vitro pull down pull down autoradiography autoradiography Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org Blood 2001 Only protein-protein interactions imex curation imex curation mehaffey-2001-3 yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org Blood 2001 Only protein-protein interactions imex curation imex curation mehaffey-2001-1 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Mehaffey MG., Newton AL., Gandhi MJ., Crossley M., Drachman JG. Rare diseases - Interactions investigated in the context of Rare genetic disease FOG1 was inferred as of mouse origin (inferred by the length of zinc finger repeats and by pmid 10329627 | Palindromic probe used for EMSA was found to be of chicken origin by 8628290 and by probe blasting. jonathand@psbc.org Blood 2001 Only protein-protein interactions imex curation imex curation gata1_human Erythroid transcription factor GATA1 ERYF1 GF1 Eryf1 GATA-binding factor 1 NF-E1 DNA-binding protein protein protein human Homo sapiens Human MEFPGLGSLGTSEPLPQFVDPALVSSTPESGVFFPSGPEGLDAAASSTAPSTATAAAAALAYYRDAEAYRHSPVFQVYPLLNCMEGIPGGSPYAGWAYGKTGLYPASTVCPTREDSPPQAVEDLDGKGSTSFLETLKTERLSPDLLTLGPALPSSLPVPNSAYGGPDFSSTFFSPTGSPLNSAAYSSPKLRGTLPLPPCEARECVNCGATATPLWRRDRTGHYLCNACGLYHKMNGQNRPLIRPKKRLIVSKRAGTQCTNCQTTTTTLWRRNASGDPVCNACGLYYKLHQVNRPLTMRKDGIQTRNRKASGKGKKKRGSSLGGTGAAEGPAGGFMVVAGGSGSGNCGEVASGLTLGPPGTAHLYQGLGPVVLSGPVSHLMPFPGPLLGSPTGSFPTGPMPPTTSTTVVAPLSS fog1_mouse Zinc finger protein ZFPM1 Zfpm1 Fog Fog1 Friend of GATA protein 1 Zinc finger protein multitype 1 protein protein mouse Mus musculus Mouse MSRRKQSNPRQIKRSLRDMEAGEEAKAMDSSPKEQEAPDPEAPAIEEPPSPPREDVSPPAVPAPPESPEDPEDMEGQELEMRPQDEEKEEKEEEAAMASPWSGPEELELALQDGQRCVRARLSLTEGLSWGPFYGSIQTRALSPEREEPGPAVTLMVDESCWLRMLPQVLTEEAANSEIYRKDDALWCRVTKVVPSGGLLYVRLVTEPHGAPRHPVQEPVEPGGLAPVHTDIQLLPQQAGMASILATAVINKDVFPCKDCGIWYRSERNLQAHLLYYCASRQRAGSPVSATEEKPKETYPNERVCPFPQCRKSCPSASSLEIHMRSHSGERPFVCLICLSAFTTKANCERHLKVHTDTLSGVCHNCGFISTTRDILYSHLVTNHMVCQPGSKGEIYSPGAGHPAAKLPPDSLAGFQQHSLMHSPLVPADKAPTPSSGLDSKAEVTNGETRVPPQNGGSSESPAAPRTIKVEAAEEPEATRASGPGEPGPQAPSRTPSPHSPNPVRVKTELSSPTPGSSPGPGELTMAGTLFLPQYVFSPDAGTTTVPTAPQASEILAKMSELVHNRLQQGAGSSGAAGTPTGLFSGTKGATCFECEITFNNINNFYVHKRLYCSGRRAPEDPPTVRRPKAATGPARAPAGAAAEPDPSRSSPGPGPREEEASGTTTPEAEAAGRGSEGSQSPGSSVDDAEDDPSRTLCEACNIRFSRHETYTVHKRYYCASRHDPPPRRPPAPTTAPGPAAPALTAPPVRTRRRRKLYELPAAGAPPPAAGPAPVPVVPSPTAELPSSPRPGSASAGPAPALSPSPVPDGPIDLSKRPRRQSPDAPTALPALADYHECTACRVSFHSLEAYLAHKKYSCPAAPLRTTALCPYCPPNGRVRGDLVEHLRQAHGLQVAKPAASPGAEPRTPAERAPRDSPDGRAPRSPSPAPENTPSDPADQGARTPSKGPPAPAPAPGGGGGHRYCRLCNIRFSSLSTFIAHKKYYCSSHAAEHVK gata1_promoter_probe gata1_promoter dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GCGCTATCAGATAAGGCCTTG gata1-zfpm1-3 3657766 N/A 3657769 unspecified role unspecified role prey prey cell lysate cell lysate in vitro translated in vitro translated protein in vitro translated region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false P15976:p.Gly208Ser mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes N/A 3657770 unspecified role unspecified role bait bait purified purified n-terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false zinc finger 1 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) physical association physical association false false false Figure 8a zfpm1-gata1-3 3657766 N/A 3657769 unspecified role unspecified role prey prey cell lysate cell lysate in vitro translated in vitro translated protein in vitro translated region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false P15976:p.Gly208Ser mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain false rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes N/A 3657770 unspecified role unspecified role bait bait purified purified n-terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false zinc finger 6 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) physical association physical association false false false Figure 8a zfpm1-gata1-4 3657766 N/A 3657769 unspecified role unspecified role prey prey cell lysate cell lysate in vitro translated in vitro translated protein in vitro translated region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false P15976:p.Gly208Ser mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes N/A 3657770 unspecified role unspecified role bait bait purified purified n-terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false zinc finger 9 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) physical association physical association false false false Figure 8a gata1-zfpm1-4 3657767 N/A 3657769 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell P15976:p.Gly208Ser mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false N/A 3657770 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed living cell living cell zinc finger 1 binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false zinc finger 6 binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Figure 8C gata1-zfpm1-5 3657767 N/A 3657769 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell P15976:p.Gly208Ser mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false N/A 3657770 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed living cell living cell zinc finger 9 binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Figure 8C gata1-gata1_promoter-1 3657768 N/A 3657769 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed cell lysate cell lysate P15976:p.Gly208Ser mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false mouse-ba_f3 Mouse pro B cells IL-3 dependent mouse-baf3 EBI-6922762 ba_f3 Mouse pro B cells IL-3 dependent BA/F3 baf3 Mouse pro B cell line. IL-3 dependent murine pro B cell line established from peripheral blood; apparently derived from BALB/c mouse. N/A 3657771 unspecified role unspecified role bait bait purified purified chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Figure 6