IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ wu-2010-10 human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. mirna interference luciferase assay miRNA interference luciferase reporter assay miRNA interference luciferase assay tag luciferase tag visualisation by luciferase assay tag luciferase Wu S., Huang S., Ding J., Zhao Y., Liang L., Liu T., Zhan R., He X. xhhe@shsci.org Oncogene 2010 imex curation Only protein-protein interactions imex curation hsa-mir-298 mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AGCAGAAGCAGGGAGGUUCUCCCA mrna_cdkn1a cyclin dependent kinase inhibitor 1A mrna messenger rna mRNA mrna human Homo sapiens Human AGCTGAGGTGTGAGCAGCTGCCGAAGTCAGTTCCTTGTGGAGCCGGAGCTGGGCGCGGATTCGCCGAGGCACCGAGGCACTCAGAGGAGGTGAGAGAGCGGCGGCAGACAACAGGGGACCCCGGGCCGGCGGCCCAGAGCCGAGCCAAGCGTGCCCGCGTGTGTCCCTGCGTGTCCGCGAGGATGCGTGTTCGCGGGTGTGTGCTGCGTTCACAGGTGTTTCTGCGGCAGGCGCCATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGCCTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGCTGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCCAAGAGGAAGCCCTAATCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCAGTTTGTGTGTCTTAATTATTATTTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTGCCCCCCAGCCTCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGAATGAGAGGTTCCTAAGAGTGCTGGGCATTTTTATTTTATGAAATACTATTTAAAGCCTCCTCATCCCGTGTTCTCCTTTTCCTCTCTCCCGGAGGTTGGGTGGGCCGGCTTCATGCCAGCTACTTCCTCCTCCCCACTTGTCCGCTGGGTGGTACCCTCTGGAGGGGTGTGGCTCCTTCCCATCGCTGTCACAGGCGGTTATGAAATTCACCCCCTTTCCTGGACACTCAGACCTGAATTCTTTTTCATTTGAGAAGTAAACAGATGGCACTTTGAAGGGGCCTCACCGAGTGGGGGCATCATCAAAAACTTTGGAGTCCCCTCACCTCCTCTAAGGTTGGGCAGGGTGACCCTGAAGTGAGCACAGCCTAGGGCTGAGCTGGGGACCTGGTACCCTCCTGGCTCTTGATACCCCCCTCTGTCTTGTGAAGGCAGGGGGAAGGTGGGGTCCTGGAGCAGACCACCCCGCCTGCCCTCATGGCCCCTCTGACCTGCACTGGGGAGCCCGTCTCAGTGTTGAGCCTTTTCCCTCTTTGGCTCCCCTGTACCTTTTGAGGAGCCCCAGCTACCCTTCTTCTCCAGCTGGGCTCTGCAATTCCCCTCTGCTGCTGTCCCTCCCCCTTGTCCTTTCCCTTCAGTACCCTCTCAGCTCCAGGTGGCTCTGAGGTGCCTGTCCCACCCCCACCCCCAGCTCAATGGACTGGAAGGGGAAGGGACACACAAGAAGAAGGGCACCCTAGTTCTACCTCAGGCAGCTCAAGCAGCGACCGCCCCCTCCTCTAGCTGTGGGGGTGAGGGTCCCATGTGGTGGCACAGGCCCCCTTGAGTGGGGTTATCTCTGTGTTAGGGGTATATGATGGGGGAGTAGATCTTTCTAGGAGGGAGACACTGGCCCCTCAAATCGTCCAGCGACCTTCCTCATCCACCCCATCCCTCCCCAGTTCATTGCACTTTGATTAGCAGCGGAACAAGGAGTCAGACATTTTAAGATGGTGGCAGTAGAGGCTATGGACAGGGCATGCCACGTGGGCTCATATGGGGCTGGGAGTAGTTGTCTTTCCTGGCACTAACGTTGAGCCCCTGGAGGCACTGAAGTGCTTAGTGTACTTGGAGTATTGGGGTCTGACCCCAAACACCTTCCAGCTCCTGTAACATACTGGCCTGGACTGTTTTCTCTCGGCTCCCCATGTGTCCTGGTTCCCGTTTCTCCACCTAGACTGTAAACCTCTCGAGGGCAGGGACCACACCCTGTACTGTTCTGTGTCTTTCACAGCTCCTCCCACAATGCTGAATATACAGCAGGTGCTCAATAAATGATTCTTAGTGACTTTACTTGTAAAAAAAAAAAAAAAAA hsa-mir-208a-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AUAAGACGAGCAAAAAGCUUGU hsa-mir-363-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AAUUGCACGGUAUCCAUCUGUA hsa-mir-657 mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human GGCAGGUUCUCACCCUCUCUAGG hsa-mir-345 5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human GCUGACUCCUAGUCCAGGGCUC hsa-mir-132-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UAACAGUCUACAGCCAUGGUCG hsa-mir-654-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UAUGUCUGCUGACCAUCACCUU hsa-mir-125a-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UCCCUGAGACCCUUUAACCUGUGA hsa-mir-639 mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AUCGCUGCGGUUGCGAGCGCUGU hsa-mir-299-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UGGUUUACCGUCCCACAUACAU hsa-mir-572 mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human GUCCGCUCGGCGGUGGCCCA hsa-mir-28-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AAGGAGCUCACAGUCUAUUGAG hsa-mir423-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AGCUCGGUCUGAGGCCCCUCAGU hsa-mir-93-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human CAAAGUGCUGUUCGUGCAGGUAG hsa-mir-515-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human GAGUGCCUUCUUUUGGAGCGUU hsa_mir_298-mrna_cdkn1a-1 3596127 N/A 3596128 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.791_795delinsgaaga mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_208a 3p-mrna_cdkn1a-1 3596127 N/A 3596130 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.816_820delinscagaa mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_363 3p-mrna_cdkn1a-1 3596127 N/A 3596131 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1520_1524delinsgacgt mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_657-mrna_cdkn1a-1 3596127 N/A 3596132 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1598_1602delinsatgga mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_345 5p-mrna_cdkn1a-1 3596127 N/A 3596133 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1902_1906delinscctca mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_132 3p-mrna_cdkn1a-1 3596127 N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.?-?delinsgtcag mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false The sequence of the primer used to mutate the miR132 site does not exist on this RNA sequence of cdkn1a nor in other 3 I have checked N/A 3596134 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_654 3p-mrna_cdkn1a-1 3596127 N/A 3596135 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1907_1911delinsgcctg mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_125a 5p-mrna_cdkn1a-1 3596127 N/A 3596136 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1774_1778delinsaatcc mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_639-mrna_cdkn1a-1 3596127 N/A 3596137 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1691_1695delinscgtta mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_299 5p-mrna_cdkn1a-1 3596127 N/A 3596138 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1795_1799delinscatct mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_572-mrna_cdkn1a-1 3596127 N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1754_1758delinscctca mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false N/A 3596139 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_28_5p-mrna_cdkn1a-1 3596127 N/A 3596140 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered r.[?_?delinsgtcag;2072_2076delinstcgag] mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false r.?_?delinsgtcag mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.2072_2076delinstcgag mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir423_3p-mrna_cdkn1a-1 3596127 N/A 3596141 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.1304_1308delinscgact mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_93 5p-mrna_cdkn1a-1 3596127 N/A 3596142 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered r.1879_1883delinsgtgaa mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false r.1199_1203delinsgtgaa mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.[1199_1203delinsgtgaa; 1879_1883delinsgtgaa] mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization In the sequences of supplementary table S4 authors have inverted Forward primers to mutate miR 93 seed sequence with Reverse primers hsa_mir_515_3p-mrna_cdkn1a-1 3596127 N/A 3596143 predetermined predetermined participant predetermined regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified N/A 3596129 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range false r.953_957delinscccgt mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig 1; Suppl fig 2 down-regulates quantity by destabilization