IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ gerber-1998-2 in vitro In vitro deamination deamination assay aminase assay deamination weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Gerber A., Grosjean H., Melcher T., Keller W., Gerber A., Grosjean H., Melcher T., Keller W. To detect the Inosine, the tRNA was digested with P1 nuclease and the reaction products were separated by TLC Keller2@ubaclu.unibas.ch The EMBO journal 1998 imex curation Only protein-protein interactions imex curation gerber-1998-1 in vitro In vitro deamination deamination assay aminase assay deamination nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Gerber A., Grosjean H., Melcher T., Keller W., Gerber A., Grosjean H., Melcher T., Keller W. Keller2@ubaclu.unibas.ch The EMBO journal 1998 imex curation Only protein-protein interactions imex curation tad1_yeast tRNA-specific adenosine deaminase 1 TAD1 tRNA-specific adenosine-37 deaminase HRA400 YGL243W protein protein yeast Saccharomyces cerevisiae Baker's yeast MVSCQGTRPCIVNLLTMPSEDKLGEEISTRVINEYSKLKSACRPIIRPSGIREWTILAGVAAINRDGGANKIEILSIATGVKALPDSELQRSEGKILHDCHAEILALRGANTVLLNRIQNYNPSSGDKFIQHNDEIPARFNLKENWELALYISRLPCGDASMSFLNDNCKNDDFIKIEDSDEFQYVDRSVKTILRGRLNFNRRNVVRTKPGRYDSNITLSKSCSDKLLMKQRSSVLNCLNYELFEKPVFLKYIVIPNLEDETKHHLEQSFHTRLPNLDNEIKFLNCLKPFYDDKLDEEDVPGLMCSVKLFMDDFSTEEAILNGVRNGFYTKSSKPLRKHCQSQVSRFAQWELFKKIRPEYEGISYLEFKSRQKKRSQLIIAIKNILSPDGWIPTRTDDVK trna ala agc tRNA ala AGC yeast trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGGCGUGUGGCGUAGUCGGUAGCGCGCUCCCUUAGCAUGGGAGAGGUCUCCGGUUCGAUUCCGGACUCGUCCA trna ala agc-1 trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna bommo Bombyx mori Silk moth AACGGGGGCGUAGCUCAGAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUACCGGGAUCGAUACCCGGCGCCUCCAAUCUCGACUGUCUUUUUCCA tad1-trna ala agc-1 1936543 N/A 1936545 enzyme enzyme neutral component neutral component tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false picpa Pichia pastoris (Yeast) Yeast Pichia pastoris N/A 1936546 enzyme target enzyme target substrate substrate neutral component neutral component Inosine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region required to bind necessary binding region required to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false deamination deamination reaction deamination false false false Fig 2, Table 1 tad1-trna ala agc-2 1936543 N/A 1936547 enzyme target enzyme target substrate substrate neutral component neutral component Inosine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false g48a required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1936545 enzyme enzyme neutral component neutral component tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false picpa Pichia pastoris (Yeast) Yeast Pichia pastoris deamination deamination reaction deamination false false false Table 1 tad1-1 1936544 N/A 1936545 enzyme enzyme neutral component neutral component tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false picpa Pichia pastoris (Yeast) Yeast Pichia pastoris N/A 1936546 enzyme target enzyme target substrate substrate neutral component neutral component Inosine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false deamination deamination reaction deamination false false false Fig 3