IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ lecointe-1998-1 in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Lecointe F., Simos G., Sauer A., Hurt EC., Motorin Y., Grosjean H. Yuri.Motorin@lebs.cnrs-gif.fr The Journal of biological chemistry 1998 imex curation Only protein-protein interactions imex curation trna phe gaa trna Phe GAA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA pus3_yeast tRNA pseudouridine(38/39) synthase YFL001W DEG1 HRM3 tRNA-uridine isomerase 3 tRNA pseudouridylate synthase 3 Depressed growth-rate protein DEG1 PUS3 tRNA pseudouridine synthase 3 protein protein yeast Saccharomyces cerevisiae Baker's yeast MSNFIRRLVGKMKAISTGTNAIVSKKDSIYANWSKEQLIRRITELENANKPHSEKFQHIEDNKKRKISQEEVTRSKAKKAPKKFDFSKHNTRFIALRFAYLGWNYNGLAVQKEYTPLPTVEGTILEAMNKCKLVPSMVLQDYKFSRCGRTDKGVSAMNQVISLEVRSNLTDEEQRDPTNDSREIPYVHVLNQLLPDDIRISAVCLRPPPNFDARFSCVHRHYKYIFNGKNLNIEKMSKAASYFVGERDFRNFCKLDGSKQITNFKRTIISSKILPLSETFYCFDLVGSAFLWHQVRCMMAILFLVGQSLEVPEIVLRLTDIEKTPQRPVYEMANDIPLLLYDCKFPEMDWQEPTVDDYKAIKFTTATEALTLHYELKAAVCNIFKDVLPTANTNNFSKTIINLGDGRGKVVGTYVKLEDRSVMEPVEVVNAKYSKKKNNKNK 89C35917366BDB9B trna ala agc tRNA ala AGC yeast trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGGCGUGUGGCGUAGUCGGUAGCGCGCUCCCUUAGCAUGGGAGAGGUCUCCGGUUCGAUUCCGGACUCGUCCA deg1-trna phe gaa-1 2857477 N/A 2857478 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false mutation mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 2857479 enzyme enzyme neutral component neutral component tag protein a tag protein a tag protein A protein A n-term range n-terminal range n-term range n-term range n-terminal range n-term range false yeast Saccharomyces cerevisiae Baker's yeast enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig 4B deg1-trna ala agc-1 2857477 N/A 2857479 enzyme enzyme neutral component neutral component tag protein a tag protein a tag protein A protein A n-term range n-terminal range n-term range n-term range n-terminal range n-term range false yeast Saccharomyces cerevisiae Baker's yeast N/A 2857480 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false in vitro In vitro enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig 4B