IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ becker-1997-1 in vitro In vitro enzymatic study enzymatic study autoradiography autoradiography Becker HF., Motorin Y., Planta RJ., Grosjean H. To detect pseudouridine modification, tRNAs were digested by nuclease P1 and RNAse T2, and run onto two-dimensional thin-layer chromatography on cellulose plates to identify modified nucleotides yuri.motorin@lebs.cnrs-gif.fr Nucleic acids research 1997 imex curation Only protein-protein interactions imex curation pus4_yeast tRNA pseudouridine synthase 4 PUS4 YNL292W N0480 tRNA pseudouridine(55) synthase tRNA-uridine isomerase 4 tRNA pseudouridylate synthase 4 protein protein yeast Saccharomyces cerevisiae Baker's yeast MNGIFAIEKPSGITSNQFMLKLQHALTKSQVFSKEIQRATAERKQQYEKQTGKKASKRKLRKVSKVKMGHGGTLDPLASGVLVIGIGAGTKKLANYLSGTVKVYESEALFGVSTTSGDVEGEILSQNSVKHLNFDDLKTVEEKFVGQLKQTPPIYAALKMDGKPLHEYAREGKPLPRAIEPRQVTIYDLKVFSDSLKRDHDYPLLRPTTEEAVDTVKNLNANMLNDVLYFSKEYTEKHGLDSEVAKVEEPFPLSEQEEQEIQKEGDSYRAPKLHFKANVSSGTYIRSLVSDIGKSMRSSCYMVKLIRLQQQDWSLEKNNVFQLTDFTERDEKVWSKVLEKVLDEGATVDVIEELKKAEKEIPADVKECIVSSDQPGDEATAETIETANAEEHSNTLKRKIEQV trna_asp_guc tRna Asp GUC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG trna phe gaa trna Phe GAA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA pus4-trna_asp_guc-1 2857353 N/A 2857354 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 2857355 enzyme target enzyme target substrate substrate neutral component neutral component pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig 4 pus4-trna phe gaa-1 2857353 N/A 2857356 enzyme target enzyme target substrate substrate neutral component neutral component pseudouriine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false A31C,U39G mutation mutation certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 2857354 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig 3