IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ cavarelli-1994-1 in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Cavarelli J The EMBO Journal 1994 imex curation Only protein-protein interactions imex curation cavarelli-1994-2 in vitro In vitro enzymatic study enzymatic study tag visualisation tag visualisation Cavarelli J The reaction mix was filtered on 0.22 micrometers pore size nitrocellulose, then dried and counted The EMBO Journal 1994 imex curation Only protein-protein interactions imex curation trna_asp_guc tRna Asp GUC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG sydc_yeast Aspartate--tRNA ligase, cytoplasmic DPS1 APS APS1 Aspartyl-tRNA synthetase L1295 YLL018C protein protein yeast Saccharomyces cerevisiae Baker's yeast MSQDENIVKAVEESAEPAQVILGEDGKPLSKKALKKLQKEQEKQRKKEERALQLEAEREAREKKAAAEDTAKDNYGKLPLIQSRDSDRTGQKRVKFVDLDEAKDSDKEVLFRARVHNTRQQGATLAFLTLRQQASLIQGLVKANKEGTISKNMVKWAGSLNLESIVLVRGIVKKVDEPIKSATVQNLEIHITKIYTISETPEALPILLEDASRSEAEAEAAGLPVVNLDTRLDYRVIDLRTVTNQAIFRIQAGVCELFREYLATKKFTEVHTPKLLGAPSEGGSSVFEVTYFKGKAYLAQSPQFNKQQLIVADFERVYEIGPVFRAENSNTHRHMTEFTGLDMEMAFEEHYHEVLDTLSELFVFIFSELPKRFAHEIELVRKQYPVEEFKLPKDGKMVRLTYKEGIEMLRAAGKEIGDFEDLSTENEKFLGKLVRDKYDTDFYILDKFPLEIRPFYTMPDPANPKYSNSYDFFMRGEEILSGAQRIHDHALLQERMKAHGLSPEDPGLKDYCDGFSYGCPPHAGGGIGLERVVMFYLDLKNIRRASLFPRDPKRLRP 6656279B3E9011A5 aspartic acid aspartic acid (+-)-Aspartic acid (R,S)-Aspartic acid 2-aminobutanedioic acid Asp Aspartic acid D DL-Aminosuccinic acid DL-Asparagic acid aspartic acid small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) trna asp-1 2863414 N/A 2863416 unspecified role unspecified role neutral component neutral component in vitro In vitro N/A 2863417 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Table 1 0.225 2.7 dps1-trna_asp_guc-1 2863414 N/A 2863418 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 2863416 unspecified role unspecified role neutral component neutral component in vitro In vitro N/A 2863417 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) N/A 2863419 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Table 1 0.212 3.0 dps1-trna_asp_guc-2 2863414 N/A 2863416 unspecified role unspecified role neutral component neutral component in vitro In vitro N/A 2863417 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) N/A 2863419 unspecified role unspecified role neutral component neutral component in vitro In vitro direct interaction direct interaction false false false Table 1 0.203 3 trna asp-2 2863415 N/A 2863416 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro N/A 2863417 enzyme enzyme neutral component neutral component P04802:p.Gln303Asn mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false P04802:p.His334Arg mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false P04802:p.Ser329Ala mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false P04802:p.His334Lys mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 2863418 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 2863415 2863415 2863415 Table 3 Authors classify residues potentially relevant for the reaction in 3 groups and identify by extensive mutagenesis analysis the essential ones, listed below: Group 1, residues that contact ATP: Arg325, Asp471, Glu478 Group 2, residues that contact amino acid: Gln303, Asp342, Arg485, Glu344, Lys306 Group 3, residues that contact tRNA: Ser301 Glu327, His334 However, individually all these residues contribute only weakly to the tRNA-enzyme binding energy, with little changes in Kd