IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ hahn-2012-1 yeast Saccharomyces cerevisiae Baker's yeast crac crac CRAC cross-linking and analysis of cDNAs crac partial nucleotide sequence partial nucleotide sequence identification partial nucleotide sequence Hahn D., Kudla G., Tollervey D., Beggs JD. Brr2 was HTP tagged- a tandem -His-TEV-Protein A tag. j.beggs@ed.ac.uk Genes & development 2012 imex curation Only protein-protein interactions imex curation hahn-2012-2 in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Hahn D., Kudla G., Tollervey D., Beggs JD. j.beggs@ed.ac.uk Genes & development 2012 imex curation Only protein-protein interactions imex curation hahn-2012-3 in vitro In vitro comigration in gel comigration in gel electrophoresis comigration in gel weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Hahn D., Kudla G., Tollervey D., Beggs JD. j.beggs@ed.ac.uk Genes & development 2012 imex curation Only protein-protein interactions imex curation snr7s_u5_yeast small nuclear RNA U5 Yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast AAGCAGCUUUACAGAUCAAUGGCGGAGGGAGGUCAACAUCAAGAACUGUGGGCCUUUUAUUGCCUAUAGAACUUAUAACGAACAUGGUUCUUGCCUUUUACCAGAACCAUCCGGGUGUUGUCUCCAUAGAAACAGGUAAAGCUGUCCGUUACUGUGGGCUUGCCAUAUUUUUUGGAACU snru6_yeast small nuclear RNA U6 Yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast GUUCGCGAAGUAACCCUUCGUGGACAUUUGGUCAAUUUGAAACAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUAUUUCGUUUU lsr1_snr20_u2 yeast small nuclear RNA U2 yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast ACGAAUCUCUUUGCCUUUUGGCUUAGAUCAAGUGUAGUAUCUGUUCUUUUCAGUGUAACAACUGAAAUGACCUCAAUGAGGCUCAUUACCUUUUAAUUUGUUACAAUACACAUUUUUUGGCACCCAAAAUAAUAAAAUGGACGGGAAGAGACUUUUUAAGCAAGUUGUUUUCCGCUAAUGUCAGGUCUCACUACUUUUUGCUGCUAUUUUUCUUCGCUCAUGGUUUCUUCAUAAGGCGUUUUUAUGAUGGUUUUUCGAAAUUGGUUUUUGAGACGACGGUUGCUCAAGGUUAUUGUUUUUGUUUUCUUCUGGUUGUUUUCUAUUUUCUUUUUUUUAGCUUUCUGUUUCUCCCUUAGUUUGGCUUUUUGCUUCAUACUCUUCCCUGUCUUUCCGAGCCGUUUAUGUCCAACGCGGGAUUUGGUUUUUCUUUAUCGAUGGGAAGAAAUGGUGCUAUAGUAGGUUGGGAGAUAAUAUUUAUGGUAUGGGGUGCUAGUGCGGAUGGGGCGCUCUUAUUGUUGAUUUCUUCGCUCGUCUUCUUUUUCUGGUGGCGCUGCAAGAGGAAGUUUUUCGACUUUGUUAUGAUUUUUGGUUUGCAAGGAAAGGUGUCUUACGAUUCUUUUUUUGAUGUAAUAGGAUAAGCUUGCUUAUCCCCCAAGUAUCGGCCAAAGUUGUUGAUUUUCCUUUUGAAGUGUCCUCGGUUUGAGGGGGUGUAGGGUGGGGUUGGUCUACAAUAAGAGUGUUCCAUUGUUAACGUGCUGGCGUCUUUUACUAUAUUUUUUUUCCCAGUUUAUUUUGUGCUUAUUUUCUCAUUGAGGAGAAGGAGCUCUUCUCGCAGGAUAUAAAUGGAGGUUUGCUAAAGGGGAGGAGAUGUGUUUGUGAGAAUACUGCUGAGAGAGUUCUGGAAGAGAAAAAAAGGAGGCAAUGGAAGGCGUUUGCUGGGAAAAGAGAAGAGCCAUGACUGCAUCUGUUGUUUCAAGGCCAGUUUUAUUAACCGCCUAUGUCAUAGAGGCGUUUUUUUUGGAGGGAUUUGAAGAAUGCCGGCGGCAUCAAGAAACGGACUUGAUGGUUGACGCCUGUUUUUAAAGUUAGAGACGUCGCGACCCUCGCACUUGUGGAGUCGUUCUUGACUUUUACUUUGGUCGCUUGAUGUUUCUCUCGUCUUCCCGUUCGCUCUU brr2_yeast Pre-mRNA-splicing helicase BRR2 BRR2 RSS1 SNU246 YER172C SYGP-ORF66 Protein Snu246 protein protein yeast Saccharomyces cerevisiae Baker's yeast MTEHETKDKAKKIREIYRYDEMSNKVLKVDKRFMNTSQNPQRDAEISQPKSMSGRISAKDMGQGLCNNINKGLKENDVAVEKTGKSASLKKIQQHNTILNSSSDFRLHYYPKDPSNVETYEQILQWVTEVLGNDIPHDLIIGTADIFIRQLKENEENEDGNIEERKEKIQHELGINIDSLKFNELVKLMKNITDYETHPDNSNKQAVAILADDEKSDEEEVTEMSNNANVLGGEINDNEDDDEEYDYNDVEVNSKKKNKRALPNIENDIIKLSDSKTSNIESVPIYSIDEFFLQRKLRSELGYKDTSVIQDLSEKILNDIETLEHNPVALEQKLVDLLKFENISLAEFILKNRSTIFWGIRLAKSTENEIPNLIEKMVAKGLNDLVEQYKFRETTHSKRELDSGDDQPQSSEAKRTKFSNPAIPPVIDLEKIKFDESSKLMTVTKVSLPEGSFKRVKPQYDEIHIPAPSKPVIDYELKEITSLPDWCQEAFPSSETTSLNPIQSKVFHAAFEGDSNMLICAPTGSGKTNIALLTVLKALSHHYNPKTKKLNLSAFKIVYIAPLKALVQEQVREFQRRLAFLGIKVAELTGDSRLSRKQIDETQVLVSTPEKWDITTRNSNNLAIVELVRLLIIDEIHLLHDDRGPVLESIVARTFWASKYGQEYPRIIGLSATLPNYEDVGRFLRVPKEGLFYFDSSFRPCPLSQQFCGIKERNSLKKLKAMNDACYEKVLESINEGNQIIVFVHSRKETSRTATWLKNKFAEENITHKLTKNDAGSKQILKTEAANVLDPSLRKLIESGIGTHHAGLTRSDRSLSEDLFADGLLQVLVCTATLAWGVNLPAHTVIIKGTDVYSPEKGSWEQLSPQDVLQMLGRAGRPRYDTFGEGIIITDQSNVQYYLSVLNQQLPIESQFVSKLVDNLNAEVVAGNIKCRNDAVNWLAYTYLYVRMLASPMLYKVPDISSDGQLKKFRESLVHSALCILKEQELVLYDAENDVIEATDLGNIASSFYINHASMDVYNRELDEHTTQIDLFRIFSMSEEFKYVSVRYEEKRELKQLLEKAPIPIREDIDDPLAKVNVLLQSYFSQLKFEGFALNSDIVFIHQNAGRLLRAMFEICLKRGWGHPTRMLLNLCKSATTKMWPTNCPLRQFKTCPVEVIKRLEASTVPWGDYLQLETPAEVGRAIRSEKYGKQVYDLLKRFPKMSVTCNAQPITRSVMRFNIEIIADWIWDMNVHGSLEPFLLMLEDTDGDSILYYDVLFITPDIVGHEFTLSFTYELKQHNQNNLPPNFFLTLISENWWHSEFEIPVSFNGFKLPKKFPPPTPLLENISISTSELGNDDFSEVFEFKTFNKIQSQVFESLYNSNDSVFVGSGKGTGKTAMAELALLNHWRQNKGRAVYINPSGEKIDFLLSDWNKRFSHLAGGKIINKLGNDPSLNLKLLAKSHVLLATPVQFELLSRRWRQRKNIQSLELMIYDDAHEISQGVYGAVYETLISRMIFIATQLEKKIRFVCLSNCLANARDFGEWAGMTKSNIYNFSPSERIEPLEINIQSFKDVEHISFNFSMLQMAFEASAAAAGNRNSSSVFLPSRKDCMEVASAFMKFSKAIEWDMLNVEEEQIVPYIEKLTDGHLRAPLKHGVGILYKGMASNDERIVKRLYEYGAVSVLLISKDCSAFACKTDEVIILGTNLYDGAEHKYMPYTINELLEMVGLASGNDSMAGKVLILTSHNMKAYYKKFLIEPLPTESYLQYIIHDTLNNEIANSIIQSKQDCVDWFTYSYFYRRIHVNPSYYGVRDTSPHGISVFLSNLVETCLNDLVESSFIEIDDTEAEVTAEVNGGDDEATEIISTLSNGLIASHYGVSFFTIQSFVSSLSNTSTLKNMLYVLSTAVEFESVPLRKGDRALLVKLSKRLPLRFPEHTSSGSVSFKVFLLLQAYFSRLELPVDFQNDLKDILEKVVPLINVVVDILSANGYLNATTAMDLAQMLIQGVWDVDNPLRQIPHFNNKILEKCKEINVETVYDIMALEDEERDEILTLTDSQLAQVAAFVNNYPNVELTYSLNNSDSLISGVKQKITIQLTRDVEPENLQVTSEKYPFDKLESWWLVLGEVSKKELYAIKKVTLNKETQQYELEFDTPTSGKHNLTIWCVCDSYLDADKELSFEINVK DFAF7E3B7168D944 snr14_u4_yeast SNR14 snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast AUCCUUAUGCACGGGAAAUACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGUUUUUGCUGGUUGAAAUUUAAUUAUAAACCAGACCGUCUCCUCAUGGUCAAUUCGGUGUUCGCUUUUGAAUACUUCAAGACUAUGUAGGGAAUUUUUGGAAUACCUUU brr2-1 1925103 N/A 1925106 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false N/A 1925107 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false N/A 1925108 unspecified role unspecified role prey prey N/A 1925109 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false tag His Tev proteinA tag tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false N/A 1925110 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false association association false false false fig1, fig 2, fig 3A, B, Fig7, Suppl fig5 mutation G858R in Brr2 alters the interaction with snRNAs: it increases the one with U5 and U6, decreases the interaction with U2 , it decreases interaction with region 30-80 of U4 and increases it with region 128-158 brr2-snru6_yeast-1 1925103 N/A 1925107 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false N/A 1925109 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false tag His Tev proteinA tag tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false P32639:p.Gly858Arg mutation mutation certain certain sequence position certain certain certain sequence position certain false association association false false false Fig7 brr2-lsr1_snr20_u2 yeast-1 1925103 N/A 1925106 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false N/A 1925107 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false N/A 1925109 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false tag His Tev proteinA tag tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false P32639:p.Gly858Arg mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain false N/A 1925110 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false association association false false false fig1, fig 2, fig 3A, B, Fig7, Suppl fig5-mutation+ mutation G858R in Brr2 alters the interaction with snRNAs: it increases the one with U5 and U6, decreases the interaction with U2 , it decreases interaction with region 30-80 of U4 and increases it with region 128-158 brr2-lsr1_snr20_u2 yeast-2 1925103 N/A 1925107 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false N/A 1925109 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false tag His Tev proteinA tag tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false P32639:p.Gly858Arg mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false N/A 1925110 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false association association false false false fig1, fig 2, fig 3A, B, Fig7, Suppl fig5-mutation2-less mutation G858R in Brr2 alters the interaction with snRNAs: it increases the one with U5 and U6, decreases the interaction with U2 , it decreases interaction with region 30-80 of U4 and increases it with region 128-158 brr2-8 1925104 N/A 1925109 unspecified role unspecified role prey prey yeast Saccharomyces cerevisiae Baker's yeast N/A 1925107 unspecified role unspecified role bait bait U4 binding binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro N/A 1925110 unspecified role unspecified role bait bait U6 binding binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro 1925155 1925152 direct interaction direct interaction false false false Fig 2D, (Supp fig 2) u4_u6-1 1925105 N/A 1925107 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast N/A 1925110 unspecified role unspecified role neutral component neutral component yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast direct interaction direct interaction false false false Suppl Fig 2 B,C,D