IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ d_silva-2011-1 in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra D'Silva S., Haider SJ., Phizicky EM. eric_phizicky@urmc.rochester.edu RNA (New York, N.Y.) 2011 imex curation Only protein-protein interactions imex curation d_silva-2011-2 in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as primer extension assay primer extension assay primer extension assay D'Silva S., Haider SJ., Phizicky EM. eric_phizicky@urmc.rochester.edu RNA (New York, N.Y.) 2011 imex curation Only protein-protein interactions imex curation trna thr agu (igu) tRNA Thr AGU (IGU) trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCUUCUAUGGCCAAGUUGGUAAGGCGCCACACUAGUAAUGUGGAGAUCAUCGGUUCAAAUCCGAUUGGAAGCA ab140_yeast tRNA(Thr) (cytosine(32)-N(3))-methyltransferase ABP140 Actin-binding protein of 140 kDa TRM140 tRNA methyltransferase of 140 kDa YOR240W YOR239W protein protein yeast Saccharomyces cerevisiae Baker's yeast MGVADLIKKFESISKEEGDATVDTNSSSKPLKSNDETKELHQQESTAVPQEVDVNEEFENEPETINSSRTAEKPLETNLPKPETNEEDEEEGSMSENKIYSKGENADINVNDFQEYKEMENTGAEVLASSVEESDAIQEGVAEETEGIATPKQKENEKNDESEEESANNASEPAEEYSQSEEDADIEQSNGKETENAENASQQANDGSTSTTTSKNKKKKNKKKNKKKRNGNVNTNANVDDSTKTGENDDTTGDTTSSTTSAIQEVNDLEVVDDSCLGIDQQHNREHLKALTQDVKEETLENIAHEGRGDNTGDQNAVEKSDFEKSDTEGSRIGRDLPFEFGKRNLTEESDVWDHNAWDNVEWGEEQVQQAEEKIKEQFKHPVPEFDKKLYNENPARYWDIFYKNNKENFFKDRKWLQIEFPILYASTRKDAEPVTIFEIGCGAGNTFFPILKDNENENLRIIAADFAPRAVELVKNSEQFNPKYGHATVWDLANPDGNLPDGVEPHSVDIAVMIFVFSALAPNQWDQAMDNLHKILKPGGKIIFRDYGAYDLTQVRFKKNRILEENFYVRGDGTRVYFFSEEKLREIFTKKYFLENKIGTDRRLLVNRKRQLKMYRCWVQAVFDVPQ trm140 trna the-1 2857369 N/A 2857371 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false C32A mutation disrupting rate mutation disrupting interaction rate mutation disrupting rate certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 2857372 enzyme enzyme neutral component neutral component 3C His6 HA ZZ tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) methylation methylation reaction methylation false false false Fg 3 B, Fig 4A, Suppl Fig 3 abp140-trna thr agu (igu)-1 2857369 N/A 2857371 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 2857372 enzyme enzyme neutral component neutral component His6 3C tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) methylation methylation reaction methylation false false false Fg 3 B abp140-trna thr agu (igu)-2 2857370 N/A 2857371 enzyme target enzyme target substrate substrate neutral component neutral component methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false yeast Saccharomyces cerevisiae Baker's yeast N/A 2857372 enzyme enzyme neutral component neutral component 3C His6 HA ZZ tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false yeast Saccharomyces cerevisiae Baker's yeast methylation methylation reaction methylation false false false Fig 4B