IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ ozanick-2009-1 in vitro In vitro ribonuclease assay ribonuclease assay weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Ozanick SG., Wang X., Costanzo M., Brost RL., Boone C., Anderson JT. james.anderson@mu.edu Nucleic acids research 2009 imex curation Only protein-protein interactions imex curation trna imet initiator tRNA Met trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast AGCGCCGUGGCGCAGUGGAAGCGCGCAGGGCUCAUAACCCUGAUGUCCUCGGAUCGAAACCGAGCGGCGCUA rexo1_yeast RNA exonuclease 1 YGR276C G9381 RNH70 REX1 RNase H(70) protein protein yeast Saccharomyces cerevisiae Baker's yeast MQVEGPDTNFVSDLALGSKKRRLSKTSVQEDDHTNVVSEVNKNKKKKKAKPMTCTLLKSVVEKGIGIKDVRDMTQYLLQAENNSPKWIDICNRSSLQKMIVLFIPGLQPDDFENGKNTFNEISDDNFKYIPGEIASTFHTFPVMAPGSKMTLFSPYNSFINVGLSKMEKINKLKELQKKKKITINDLVLSEQQLVANDYPLDSGDTNFDTDWVQTVDFTHGGSHIFALDCEMCLSEQGLVLTRISLVNFDNEVIYEELVKPDVPIVDYLTRYSGITEEKLTVGAKKTLREVQKDLLKIISRSDILIGHSLQNDLKVMKLKHPLVVDTAIIYHHKAGDPFKPSLKYLSETFLNKSIQNGEHDSVEDARACLELTKLKILNGLAFGIGINTENLFTKLHRFEVKTVLLNDMIIKNHTEDDSKGQLIRCVEDDETWTHIHENLNKDVKLIVGRIKNLERSRNYNKKPRKETPSFDASMVLHDIGQHLTQLYENATPGTMILIMSGTGDTRPWNNLSTELEFIQDKKERLDKRREREPEIVEAIKLARGGVASFTVK rex1-1 1936666 N/A 1936667 enzyme target enzyme target substrate substrate neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 1936668 enzyme enzyme neutral component neutral component tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false P53331:p.Glu231Ala mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false P53331:p.Asp229Ala mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false yeast Saccharomyces cerevisiae Baker's yeast rna cleavage rna cleavage false false false Fig 6 The exonuclease activity is active on both CCA containing and CCA lacking metRNA i.