IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ johansson-2004-2 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Johansson MJ., Byström AS. Anders.Bystrom@molbiol.umu.se Anders.Bystrom@ molbiol.umu.se RNA (New York, N.Y.) 2004 imex curation Only protein-protein interactions imex curation johansson-2004-1 in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Johansson MJ., Byström AS. Anders.Bystrom@molbiol.umu.se Anders.Bystrom@ molbiol.umu.se RNA (New York, N.Y.) 2004 imex curation Only protein-protein interactions imex curation tan1_yeast tRNA acetyltransferase TAN1 TAN1 YGL232W protein protein yeast Saccharomyces cerevisiae Baker's yeast MGEKRNRNGKDANSQNRKKFKVSSGFLDPGTSGIYATCSRRHERQAAQELQLLFEEKFQELYGDIKEGEDESENDEKKDLSIEDQIKKELQELKGEETGKDLSSGETKKKDPLAFIDLNCECVTFCKTRKPIVPEEFVLSIMKDLADPKNMVKRTRYVQKLTPITYSCNAKMEQLIKLANLVIGPHFHDPSNVKKNYKFAVEVTRRNFNTIERMDIINQVVKLVNKEGSEFNHTVDLKNYDKLILVECFKSNIGMCVVDGDYKTKYRKYNVQQLYESKFRKDEDKSVKQ trna ser cga tRNA serine CGA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGCACUAUGGCCGAGUGGUUAAGGCGAGAGACUCGAAAUCUCUUGGGCUCUGCCCGCGCUGGUUCAAAUCCUGCUGGUGUCG trna glu uuc trna glu UUC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast UCCGAUAUAGUGUAACGGCUAUCACAUCACGCUUUCACCGUGGAGACCGGGGUUCGACUCCCCGUAUCGGAG trna ser cga-tan1-1 1931064 N/A 1931066 unspecified role unspecified role prey prey tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 1931067 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false Fig 4B trna glu uuc-tan1-1 1931064 N/A 1931066 unspecified role unspecified role prey prey tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 1931068 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false Fig 4C tan1-1 1931065 N/A 1931066 unspecified role unspecified role prey prey tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 1931067 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false Fig 4B