IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ jackman-2003-1 in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as predetermined predetermined participant predetermined Jackman JE., Montange RK., Malik HS., Phizicky EM. Nucleosides were analysed by HPLC eric_phizicky@urmc.rochester.edu eric_phizicky@urmc.rochester RNA (New York, N.Y.) 2003 imex curation Only protein-protein interactions imex curation s-adenosyl-l-methionine S adenosyl Methionine small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) trm10_yeast tRNA (guanine(9)-N1)-methyltransferase TRM10 tRNA methyltransferase 10 tRNA(m1G9)-methyltransferase O0926 YOL093W protein protein yeast Saccharomyces cerevisiae Baker's yeast MSNDEINQNEEKVKRTPPLPPVPEGMSKKQWKKMCKRQRWEENKAKYNAERRVKKKRLRHERSAKIQEYIDRGEEVPQELIREPRINVNQTDSGIEIILDCSFDELMNDKEIVSLSNQVTRAYSANRRANHFAEIKVAPFDKRLKQRFETTLKNTNYENWNHFKFLPDDKIMFGDEHISKDKIVYLTADTEEKLEKLEPGMRYIVGGIVDKNRYKELCLKKAQKMGIPTRRLPIDEYINLEGRRVLTTTHVVQLMLKYFDDHNWKNAFESVLPPRKLDAEAKSASSSPAPKDT trna_gly_gcc tRNA_Gly_GCC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCGCAAGUGGUUUAGUGGUAAAAUCCAACGUUGCCAUCGUUGGGCCCCCGGUUCGAUUCCGGGCUUGCGCA trna gly trm10-1 2845894 N/A 2845895 unspecified role unspecified role ancillary ancillary in vitro In vitro N/A 2845896 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 2845897 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain false N1 Methyl G rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false in vitro In vitro methylation methylation reaction methylation false false false Fig 5