IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ normand-2006-1 in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Normand C., Capeyrou R., Quevillon-Cheruel S., Mougin A., Henry Y., Caizergues-Ferrer M. henry@ibcg.biotoul.fr RNA (New York, N.Y.) 2006 imex curation Only protein-protein interactions imex curation normand-2006-2 in vitro In vitro footprinting footprinting partial nucleotide sequence partial nucleotide sequence identification partial nucleotide sequence Normand C., Capeyrou R., Quevillon-Cheruel S., Mougin A., Henry Y., Caizergues-Ferrer M. henry@ibcg.biotoul.fr RNA (New York, N.Y.) 2006 imex curation Only protein-protein interactions imex curation snr5 yeast small nucleolar RNA 5 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast AUCAUUCAAUAAACUGAUCUUCCGGAUUACCAUGCUUAAGACAUCACGCCUCCAUAUGUCUAUAUAAAGCGCAAAUGGCUGGAAGUAGACCAAUUUUUUUUGUUCCUAGCUUUUCAUUAUUGAAAUCUAAUCCAGUUUUAAUGGUUUUUCUUAAUUAAGAAAACAAAUUAUCAUUGGUUCGCUCUAGGUGUACAUAUCUUCACU cbf5_yeast H/ACA ribonucleoprotein complex subunit CBF5 Small nucleolar RNP protein CBF5 L9470.11 YLR175W CBF5 Centromere/microtubule-binding protein CBF5 Centromere-binding factor 5 H/ACA snoRNP protein CBF5 p64' protein protein yeast Saccharomyces cerevisiae Baker's yeast MSKEDFVIKPEAAGASTDTSEWPLLLKNFDKLLVRSGHYTPIPAGSSPLKRDLKSYISSGVINLDKPSNPSSHEVVAWIKRILRCEKTGHSGTLDPKVTGCLIVCIDRATRLVKSQQGAGKEYVCIVRLHDALKDEKDLGRSLENLTGALFQRPPLISAVKRQLRVRTIYESNLIEFDNKRNLGVFWASCEAGTYMRTLCVHLGMLLGVGGHMQELRRVRSGALSENDNMVTLHDVMDAQWVYDNTRDESYLRSIIQPLETLLVGYKRIVVKDSAVNAVCYGAKLMIPGLLRYEEGIELYDEIVLITTKGEAIAVAIAQMSTVDLASCDHGVVASVKRCIMERDLYPRRWGLGPVAQKKKQMKADGKLDKYGRVNENTPEQWKKEYVPLDNAEQSTSSSQETKETEEEPKKAKEDSLIKEVETEKEEVKEDDSKKEKKEKKDKKEKKEKKEKKDKKEKKEKKEKKRKSEDGDSEEKKSKKSKK D356B39FDCC32E2D snr24 yeast u24 small nuclear RNA 24 U24 snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast UCAAAUGAUGUAAUAACAUAUUUGCUACUUCAGAUGGAACUUUGAGUUCCGAAUGAGACAUACCAAUUAUCACCAAGAUCUCUGAUGAA snr5_cbf5-1 1858910 N/A 1858912 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false N/A 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false A192C,C193G, A194C mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 1858913 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Fig2B, Fig3ABC, Fig4 cbf5-snr5 yeast-1 1858910 N/A 1858914 competitor competitor competitor prey prey in vitro In vitro N/A 1858912 unspecified role unspecified role bait bait N/A 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro N/A 1858913 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) physical association physical association false false false Fig2C, Fig3E U24 does not affect the binding snr5_cbf5 cbf5-snr5 yeast-2 1858910 N/A 1858912 competitor competitor competitor prey prey in vitro In vitro N/A 1858912 unspecified role unspecified role bait bait N/A 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro N/A 1858913 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) physical association physical association false false false Fig2C cbf5_snr5-1 1858911 N/A 1858913 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) N/A 1858912 unspecified role unspecified role neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain false region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Fig5A,C cbf5-snr5 yeast-3 1858911 N/A 1858913 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) N/A 1858912 unspecified role unspecified role neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain false region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Fig5B