NTNU NTNU, Norwegian University of Science and Technology www.ntnu.no/home kim-2002e-3 Activation of the murine type II transforming growth factor-beta receptor gene: up-regulation and function of the transcription factor Elf-3/Ert/Esx/Ese-1. mouse-f9 Mus musculus f9 Mouse F9 129 embryo teratocarcinoma emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Kim J.H., Wilder P.J., Hou J., Nowling T., Rizzino A. arizzino@unmc.edu J. Biol. Chem. (0021-9258) 2002 imex curation kim-2002e-1 Activation of the murine type II transforming growth factor-beta receptor gene: up-regulation and function of the transcription factor Elf-3/Ert/Esx/Ese-1. human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Kim J.H., Wilder P.J., Hou J., Nowling T., Rizzino A. arizzino@unmc.edu J. Biol. Chem. (0021-9258) 2002 imex curation kim-2002e-2 Activation of the murine type II transforming growth factor-beta receptor gene: up-regulation and function of the transcription factor Elf-3/Ert/Esx/Ese-1. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Kim J.H., Wilder P.J., Hou J., Nowling T., Rizzino A. arizzino@unmc.edu J. Biol. Chem. (0021-9258) 2002 imex curation kim-2002e-4 Activation of the murine type II transforming growth factor-beta receptor gene: up-regulation and function of the transcription factor Elf-3/Ert/Esx/Ese-1. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Kim J.H., Wilder P.J., Hou J., Nowling T., Rizzino A. arizzino@unmc.edu J. Biol. Chem. (0021-9258) 2002 imex curation tgfbr2_mouse_gene_oligo_mutant transforming growth factor, beta receptor II mutant oligo used in EMSA ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TGGCGAGGAGTTTGGATCCACCCTCTCGGCGC tgfr2_mouse_gene TGF beta receptor type II gene gene mouse Mus musculus Mouse elf3_mouse ETS-related transcription factor Elf-3 Elf3 Ert Esx Jen E74-like factor 3 Epithelial-restricted with serine box Epithelium-restricted Ets protein ESX Epithelium-specific Ets transcription factor 1 protein protein mouse Mus musculus Mouse MAATCEISNVFSNYFNAMYSSEDPTLAPAPPTTFGTEDLVLTLNNQQMTLEGPGPQTRSQRDRTDPLAVLHLAEKASWTSERPQFWSKTQVLEWISYQVEKNKYDASSIDFSRCDMDGATLCSCALEELRLVFGPLGDQLHAQLRDLTSNSSDELSWIIELLEKDGMSFQESLGDSGPFDQGSPFAQELLDDGRQASPYYCSTYGPGAPSPGSSDVSTARTATPQSSHASDSGGSDVDLDLTESKVFPRDGFPDYKKGEPKHGKRKRGRPRKLSKEYWDCLEGKKSKHAPRGTHLWEFIRDILIHPELNEGLMKWENRHEGVFKFLRSEAVAQLWGQKKKNSNMTYEKLSRAMRYYYKREILERVDGRRLVYKFGKNSSGWKEEEVGESRN elf3-tgfbr2-8 1436866 n/a 1436870 unspecified role unspecified role unspecified role unspecified role c14g_c15g_t16a_g17t_t18c_t19c_c20a mutation mutation certain certain sequence position certain certain certain sequence position certain false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false n/a 1436871 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region +3 to +34 of the mouse tgfbr2 gene used as probe: 5′-TGGCGAGGAGTTTCCTGTTTCCCTCTCGGCGC-3′ n/a 1436872 unspecified role unspecified role bait bait tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Figure 8C elf3-tgfbr2-10 1436866 n/a 1436871 unspecified role unspecified role prey prey promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1436872 unspecified role unspecified role bait bait tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Figure 8C Q3UPW2 increases expression at RNA level of ENSMUSG00000032440 mouse Elf 3 (Q3UPW2) increases expression of mouse transforming growth factor, beta receptor II (ENSMUSG00000032440) (increases activity of regulatory region promoter measured in reporter gene assay in mouse F9 cells) - shown in Figure 5 elf3-tgfbr2-4 1436867 n/a 1436871 unspecified role unspecified role prey prey promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1436872 unspecified role unspecified role bait bait tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false this is the DNA binding domain of mouse elf3 association association false false false Figure 9 elf3-tgfbr2-6 1436868 n/a 1436871 unspecified role unspecified role prey prey promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region +3 to +34 of the mouse tgfbr2 gene used as probe: 5′-TGGCGAGGAGTTTCCTGTTTCCCTCTCGGCGC-3′ n/a 1436872 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false Figure 8A elf3-tgfbr2-9 1436869 n/a 1436871 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region +3 to +34 of the mouse tgfbr2 gene used as probe: 5′-TGGCGAGGAGTTTCCTGTTTCCCTCTCGGCGC-3′ n/a 1436872 unspecified role unspecified role bait bait tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 1436905 1436902 physical association physical association false false false Figure 8A