IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ parrish-2003-4 CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu EMBO J. (0261-4189) 2003 Only protein-protein interactions imex curation parrish-2003-1 CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. in vitro In vitro pull down pull down weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu EMBO J. (0261-4189) 2003 Only protein-protein interactions imex curation parrish-2003-2 CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu EMBO J. (0261-4189) 2003 Only protein-protein interactions imex curation parrish-2003-3 CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation. in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Parrish JZ., Yang C., Shen B., Xue D. Apoptosis - Interactions involving proteins with a function related to apoptosis 5' - 3' exo nuclease assay:cleavage of:- (1)a labeled 5′ blunt end of a double-stranded oligonucleotide substrate and (2) a double-stranded substrate containing a 5′ recessed end and a labeled 3′ blunt end - to generate low molecular weight labeled nucleotides. Cleavage products were detected using a phosphorimager. ding.xue@colorado.edu EMBO J. (0261-4189) 2003 Only protein-protein interactions imex curation cttgaggcagagtcc 5′-CTTGAGGCAGAGTCC-3′ dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CTTGAGGCAGAGTCC nucg_caeel Endonuclease G, mitochondrial Ced-3 protease suppressor 6 cps-6 C41D11.8 protein protein caeel Caenorhabditis elegans MIGKVAGTAAIAGISFLAGKYSNDDLPIFRNVQSATNVPMNQIQVSEPMTVKPASLNADAMGPSRSAEIMKHGYPGFTNVRTYEDFVLSYDYKTRTAHWVCEHLTPERLKHAEGVDRKLCEFKPDITFPQKFLSQNTDYKCSGFDRGHLAAAGNHRKSQLAVDQTFYLSNMSPQVGRGFNRDKWNDLEMHCRRVAKKMINSYIITGPLYLPKLEGDGKKYIKYQVIGDNNVAVPTHFFKVALFEVTPGKFELESYILPNAVIEDTVEISKFHVPLDAVERSAGLEIFARLDPKSIVKENGAKKGGLLW fen1_caeel Flap endonuclease 1 Y47G6A.8 crn-1 Cell death-related nuclease 1 Flap structure-specific endonuclease 1 protein protein caeel Caenorhabditis elegans MGIKGLSQVIADNAPSAIKVNEMKAFFGRTVAIDASMCLYQFLIAVRQDGSQLQSEDGETTSHLMGMLNRTVRMFENGVKPVYVFDGKPPDMKGGELEKRSERRAEAEKALTEAKEKGDVKEAEKFERRLVKVTKQQNDEAKRLLGLMGIPVVEAPCEAEAQCAHLVKAGKVFGTVTEDMDALTFGSTVLLRHFLAPVAKKIPIKEFNLSLALEEMKLSVEEFIDLCILLGCDYCGTIRGVGPKKAVELIRQHKNIETILENIDQNKYPPPEDWPYKRARELFLNPEVTKPEEVELTWKEADVEGVIQFLCGEKNFNEERIRNALAKLKTSRKSGTQGRIDSFFGNSTKVTCVTAATKRKAEEAEKAKKGAKKGGPPKKRAK ggactctgcctcaagacggtagtcaacgtggtgtg 5′-GGACTCTGCCTCAAGACGGTAGTCAACGTGGTGTG-3′ dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GGACTCTGCCTCAAGACGGTAGTCAACGTGGTGTG cacaccacgttgactaccgt_minus_1-4_nucleotides_at_3'_end 5′-CACACCACGTTGACTACCGT-3′ minus_1-4_nucleotides at 3' end dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CACACCACGTTGACTACCGT cacgttgactaccgtc 5′-CACGTTGACTACCGTC-3′ dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CACGTTGACTACCGTC ggactctgcctcaagacggtagtcaacgtg 5′- GGACTCTGCCTCAAGACGGTAGTCAACGTG-3′ dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GGACTCTGCCTCAAGACGGTAGTCAACGTG gatgtcaagcagtcctaactttgaggcagtcc (5′- GATGTCAAGCAGTCCTAACTTTGAGGCAGAGTCC-3′) dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GATGTCAAGCAGTCCTAACTTTGAGGCAGAGTCC cacaccacgttg-cps_6-1 1154781 n/a 1154785 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154786 stimulator stimulator ancillary ancillary in vitro In vitro n/a 1154787 enzyme enzyme neutral component neutral component Q9N3T2:p.Glu160Asp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false Q9N3T2:p.Asp233_Tyr234delinsAlaAla mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false in vitro In vitro n/a 1154788 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154789 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig 2C, 3D. cacaccacgttg-cps_6-2 1154781 n/a 1154788 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154785 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154787 enzyme enzyme neutral component neutral component Q9N3T2:p.Asp233_Tyr234delinsAlaAla mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false Q9N3T2:p.Glu160Asp mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false in vitro In vitro n/a 1154786 stimulator stimulator ancillary ancillary in vitro In vitro phosphotransfer phosphotransfer reaction phosphotransfer false false false Fig 2D, 3D. crn_1-cps_6 1154782 n/a 1154787 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) n/a 1154786 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 1154814 1154811 direct interaction direct interaction false false false Fig 2A cacaccacgttgac-cps_6 1154783 n/a 1154785 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154786 stimulator stimulator ancillary ancillary in vitro In vitro n/a 1154788 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154789 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154787 enzyme enzyme neutral component neutral component Q9N3T2:p.Glu160Asp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false Q9N3T2:p.Asp233_Tyr234delinsAlaAla mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false in vitro In vitro physical association physical association false false false Fig 2C, 3C. cacgttgactaccg-cps_6 1154784 n/a 1154790 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154791 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154792 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1154787 enzyme enzyme neutral component neutral component Q9N3T2:p.Glu160Asp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false Q9N3T2:p.Asp233_Tyr234delinsAlaAla mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false in vitro In vitro physical association physical association false false false Fig 2B