MINT MINT, Dpt of Biology, University of Rome Tor Vergata MINT http://mint.bio.uniroma2.it/mint url>http://mint.bio.uniroma2.it/mint/ https://mint.bio.uniroma2.it MINT-[0-9]+ https://mint.bio.uniroma2.it/index.php/results-interactions/?id=${ac} The Molecular INTeraction database (MINT) is a relational database designed to store interactions between biological molecules. http://mint.bio.uniroma2.it http://mint.bio.uniroma2.it/mint gerhartz-1996-1 Differential activation of acute phase response factor/STAT3 and STAT1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating STAT1 activation. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Gerhartz C., Heesel B., Sasse J., Hemmann U., Landgraf C., Schneider-Mergener J., Horn F., Heinrich PC., Graeve L. SH2 J. Biol. Chem. (0021-9258) 1996 partial coverage rapid curation gerhartz-1996-2 Differential activation of acute phase response factor/STAT3 and STAT1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating STAT1 activation. in vitro In vitro competition binding competition binding predetermined predetermined participant predetermined Gerhartz C., Heesel B., Sasse J., Hemmann U., Landgraf C., Schneider-Mergener J., Horn F., Heinrich PC., Graeve L. SH2 J. Biol. Chem. (0021-9258) 1996 partial coverage rapid curation c-fos promoter region SIE-oligonucleotide from the c-fos promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GATCCGGGAGGGATTTACGGGGAAATGCTG stat3_mouse Signal transducer and activator of transcription 3 Acute-phase response factor Stat3 Aprf protein protein mouse Mus musculus Mouse MAQWNQLQQLDTRYLEQLHQLYSDSFPMELRQFLAPWIESQDWAYAASKESHATLVFHNLLGEIDQQYSRFLQESNVLYQHNLRRIKQFLQSRYLEKPMEIARIVARCLWEESRLLQTAATAAQQGGQANHPTAAVVTEKQQMLEQHLQDVRKRVQDLEQKMKVVENLQDDFDFNYKTLKSQGDMQDLNGNNQSVTRQKMQQLEQMLTALDQMRRSIVSELAGLLSAMEYVQKTLTDEELADWKRRQQIACIGGPPNICLDRLENWITSLAESQLQTRQQIKKLEELQQKVSYKGDPIVQHRPMLEERIVELFRNLMKSAFVVERQPCMPMHPDRPLVIKTGVQFTTKVRLLVKFPELNYQLKIKVCIDKDSGDVAALRGSRKFNILGTNTKVMNMEESNNGSLSAEFKHLTLREQRCGNGGRANCDASLIVTEELHLITFETEVYHQGLKIDLETHSLPVVVISNICQMPNAWASILWYNMLTNNPKNVNFFTKPPIGTWDQVAEVLSWQFSSTTKRGLSIEQLTTLAEKLLGPGVNYSGCQITWAKFCKENMAGKGFSFWVWLDNIIDLVKKYILALWNEGYIMGFISKERERAILSTKPPGTFLLRFSESSKEGGVTFTWVEKDISGKTQIQSVEPYTKQQLNNMSFAEIIMGYKIMDATNILVSPLVYLYPDIPKEEAFGKYCRPESQEHPEADPGSAAPYLKTKFICVTPTTCSNTIDLPMSPRTLDSLMQFGNNGEGAEPSAGGQFESLTFDMDLTSECATSPM ingr1_human Interferon gamma receptor 1 IFNGR1 CDw119 Interferon gamma receptor alpha-chain protein protein human Homo sapiens Human MALLFLLPLVMQGVSRAEMGTADLGPSSVPTPTNVTIESYNMNPIVYWEYQIMPQVPVFTVEVKNYGVKNSEWIDACINISHHYCNISDHVGDPSNSLWVRVKARVGQKESAYAKSEEFAVCRDGKIGPPKLDIRKEEKQIMIDIFHPSVFVNGDEQEVDYDPETTCYIRVYNVYVRMNGSEIQYKILTQKEDDCDEIQCQLAIPVSSLNSQYCVSAEGVLHVWGVTTEKSKEVCITIFNSSIKGSLWIPVVAALLLFLVLSLVFICFYIKKINPLKEKSIILPKSLISVVRSATLETKPESKYVSLITSYQPFSLEKEVVCEEPLSPATVPGMHTEDNPGKVEHTEELSSITEVVTTEENIPDVVPGSHLTPIERESSSPLSSNQSEPGSIALNSYHSRNCSESDHSRNGFDTDSSCLESHSSLSDSEFPPNNKGEIKTEGQELITVIKAPTSFGYDKPHVLVDLLVDDSGKESLIGYRPTEDSKEFS stat1_human Signal transducer and activator of transcription 1-alpha/beta STAT1 Transcription factor ISGF-3 components p91/p84 protein protein human Homo sapiens Human MSQWYELQQLDSKFLEQVHQLYDDSFPMEIRQYLAQWLEKQDWEHAANDVSFATIRFHDLLSQLDDQYSRFSLENNFLLQHNIRKSKRNLQDNFQEDPIQMSMIIYSCLKEERKILENAQRFNQAQSGNIQSTVMLDKQKELDSKVRNVKDKVMCIEHEIKSLEDLQDEYDFKCKTLQNREHETNGVAKSDQKQEQLLLKKMYLMLDNKRKEVVHKIIELLNVTELTQNALINDELVEWKRRQQSACIGGPPNACLDQLQNWFTIVAESLQQVRQQLKKLEELEQKYTYEHDPITKNKQVLWDRTFSLFQQLIQSSFVVERQPCMPTHPQRPLVLKTGVQFTVKLRLLVKLQELNYNLKVKVLFDKDVNERNTVKGFRKFNILGTHTKVMNMEESTNGSLAAEFRHLQLKEQKNAGTRTNEGPLIVTEELHSLSFETQLCQPGLVIDLETTSLPVVVISNVSQLPSGWASILWYNMLVAEPRNLSFFLTPPCARWAQLSEVLSWQFSSVTKRGLNVDQLNMLGEKLLGPNASPDGLIPWTRFCKENINDKNFPFWLWIESILELIKKHLLPLWNDGCIMGFISKERERALLKDQQPGTFLLRFSESSREGAITFTWVERSQNGGEPDFHAVEPYTKKELSAVTFPDIIRNYKVMAAENIPENPLKYLYPNIDKDHAFGKYYSRPKEAPEPMELDGPKGTGYIKTELISVSEVHPSRLQTTDNLLPMSPEEFDEVSRIVGSVEFDSMMNTV il6rb_human Interleukin-6 receptor subunit beta IL6ST Interleukin-6 signal transducer Membrane glycoprotein 130 CDw130 Oncostatin-M receptor subunit alpha protein protein human Homo sapiens Human MLTLQTWLVQALFIFLTTESTGELLDPCGYISPESPVVQLHSNFTAVCVLKEKCMDYFHVNANYIVWKTNHFTIPKEQYTIINRTASSVTFTDIASLNIQLTCNILTFGQLEQNVYGITIISGLPPEKPKNLSCIVNEGKKMRCEWDGGRETHLETNFTLKSEWATHKFADCKAKRDTPTSCTVDYSTVYFVNIEVWVEAENALGKVTSDHINFDPVYKVKPNPPHNLSVINSEELSSILKLTWTNPSIKSVIILKYNIQYRTKDASTWSQIPPEDTASTRSSFTVQDLKPFTEYVFRIRCMKEDGKGYWSDWSEEASGITYEDRPSKAPSFWYKIDPSHTQGYRTVQLVWKTLPPFEANGKILDYEVTLTRWKSHLQNYTVNATKLTVNLTNDRYLATLTVRNLVGKSDAAVLTIPACDFQATHPVMDLKAFPKDNMLWVEWTTPRESVKKYILEWCVLSDKAPCITDWQQEDGTVHRTYLRGNLAESKCYLITVTPVYADGPGSPESIKAYLKQAPPSKGPTVRTKKVGKNEAVLEWDQLPVDVQNGFIRNYTIFYRTIIGNETAVNVDSSHTEYTLSSLTSDTLYMVRMAAYTDEGGKDGPEFTFTTPKFAQGEIEAIVVPVCLAFLLTTLLGVLFCFNKRDLIKKHIWPNVPDPSKSHIAQWSPHTPPRHNFNSKDQMYSDGNFTDVSVVEIEANDKKPFPEDLKSLDLFKKEKINTEGHSSGIGGSSCMSSSRPSISSSDENESSQNTSSTVQYSTVVHSGYRHQVPSVQVFSRSESTQPLLDSEERPEDLQLVDHVDGGDGILPRQQYFKQNCSQHESSPDISHFERSKQVSSVNEEDFVRLKQQISDHISQSCGSGQMKMFQEVSAADAFGPGTEGQVERFETVGMEAATDEGMPKSYLPQTVRQGGYMPQ stat3_human Signal transducer and activator of transcription 3 Acute-phase response factor STAT3 APRF protein protein human Homo sapiens Human MAQWNQLQQLDTRYLEQLHQLYSDSFPMELRQFLAPWIESQDWAYAASKESHATLVFHNLLGEIDQQYSRFLQESNVLYQHNLRRIKQFLQSRYLEKPMEIARIVARCLWEESRLLQTAATAAQQGGQANHPTAAVVTEKQQMLEQHLQDVRKRVQDLEQKMKVVENLQDDFDFNYKTLKSQGDMQDLNGNNQSVTRQKMQQLEQMLTALDQMRRSIVSELAGLLSAMEYVQKTLTDEELADWKRRQQIACIGGPPNICLDRLENWITSLAESQLQTRQQIKKLEELQQKVSYKGDPIVQHRPMLEERIVELFRNLMKSAFVVERQPCMPMHPDRPLVIKTGVQFTTKVRLLVKFPELNYQLKIKVCIDKDSGDVAALRGSRKFNILGTNTKVMNMEESNNGSLSAEFKHLTLREQRCGNGGRANCDASLIVTEELHLITFETEVYHQGLKIDLETHSLPVVVISNICQMPNAWASILWYNMLTNNPKNVNFFTKPPIGTWDQVAEVLSWQFSSTTKRGLSIEQLTTLAEKLLGPGVNYSGCQITWAKFCKENMAGKGFSFWVWLDNIIDLVKKYILALWNEGYIMGFISKERERAILSTKPPGTFLLRFSESSKEGGVTFTWVEKDISGKTQIQSVEPYTKQQLNNMSFAEIIMGYKIMDATNILVSPLVYLYPDIPKEEAFGKYCRPESQEHPEADPGSAAPYLKTKFICVTPTTCSNTIDLPMSPRTLDSLMQFGNNGEGAEPSAGGQFESLTFDMELTSECATSPM 6C00632211C8012D c_fos_promoter_region-ifngr1 990949 n/a 990951 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false stat3_mouse STAT3_MOUSE 990952 unspecified role unspecified role unspecified role unspecified role ingr1_human INGR1_HUMAN 990953 unspecified role unspecified role prey prey phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false homomint mint Fig. 3 c_fos_promoter_region-ifngr1-1 990949 n/a 990951 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false stat1_human STAT1_HUMAN 990954 unspecified role unspecified role prey prey ingr1_human INGR1_HUMAN 990953 unspecified role unspecified role prey prey phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig. 3 c_fos_promoter_region-il6st 990949 n/a 990951 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false stat3_mouse STAT3_MOUSE 990952 unspecified role unspecified role prey prey il6rb_human IL6RB_HUMAN 990955 unspecified role unspecified role prey prey phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false homomint mint Fig. 3 c_fos_promoter_region-il6st-1 990949 n/a 990951 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false stat1_human STAT1_HUMAN 990954 unspecified role unspecified role prey prey il6rb_human IL6RB_HUMAN 990955 unspecified role unspecified role prey prey phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false homomint mint Fig. 3 c_fos_promoter_region-il6st-2 990949 n/a 990951 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false stat3_mouse STAT3_MOUSE 990952 unspecified role unspecified role prey prey il6rb_human IL6RB_HUMAN 990955 unspecified role unspecified role prey prey binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false homomint mint Fig. 3 c_fos_promoter_region-stat3 990949 n/a 990951 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false stat3_human STAT3_HUMAN 990956 unspecified role unspecified role prey prey binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false stat3_mouse STAT3_MOUSE 990952 unspecified role unspecified role prey prey physical association physical association false false false homomint mint Fig. 3 c_fos_promoter_region-stat1 990949 n/a 990951 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false stat3_human STAT3_HUMAN 990956 unspecified role unspecified role prey prey binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false stat1_human STAT1_HUMAN 990954 unspecified role unspecified role prey prey association association false false false homomint mint Fig. 3 ifngr1-stat3-1 990950 stat3_mouse STAT3_MOUSE 990952 unspecified role unspecified role unspecified role unspecified role ingr1_human INGR1_HUMAN 990953 unspecified role unspecified role unspecified role unspecified role phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false association association false false false homomint mint ifngr1-stat1-4 990950 ingr1_human INGR1_HUMAN 990953 unspecified role unspecified role unspecified role unspecified role phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false stat1_human STAT1_HUMAN 990954 unspecified role unspecified role unspecified role unspecified role association association false false false homomint mint il6st-stat3-3 990950 il6rb_human IL6RB_HUMAN 990955 unspecified role unspecified role unspecified role unspecified role binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false stat3_mouse STAT3_MOUSE 990952 unspecified role unspecified role unspecified role unspecified role association association false false false homomint mint il6st-stat1-1 990950 il6rb_human IL6RB_HUMAN 990955 unspecified role unspecified role unspecified role unspecified role binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false stat1_human STAT1_HUMAN 990954 unspecified role unspecified role unspecified role unspecified role association association false false false homomint mint il6st-stat3-5 990950 stat3_mouse STAT3_MOUSE 990952 unspecified role unspecified role unspecified role unspecified role il6rb_human IL6RB_HUMAN 990955 unspecified role unspecified role unspecified role unspecified role phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false association association false false false homomint mint stat3-stat3-3 990950 stat3_mouse STAT3_MOUSE 990952 unspecified role unspecified role unspecified role unspecified role stat3_human STAT3_HUMAN 990956 unspecified role unspecified role unspecified role unspecified role binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false association association false false false homomint mint stat1-stat3-2 990950 stat1_human STAT1_HUMAN 990954 unspecified role unspecified role unspecified role unspecified role stat3_human STAT3_HUMAN 990956 unspecified role unspecified role unspecified role unspecified role phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain false binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false association association false false false homomint mint