IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ huang-2007-4 Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. in vitro In vitro protein kinase assay protein kinase assay predetermined predetermined participant predetermined Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation huang-2007-1 Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid full dna sequence full identification by DNA sequencing full dna sequence Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. krensky@stanford.edu Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation huang-2007-2 Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation huang-2007-3 Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation huang-2007-5 Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation huang-2007-6 Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 imaging technique imaging technique microscopy immunostaining immunostaining Huang B., Ahn YT., McPherson L., Clayberger C., Krensky AM. Source of PRPF4B taken from PMID: 11418604 krensky@stanford.edu Human thymus cDNA J. Immunol. (0022-1767) 2007 Only protein-protein interactions imex curation prp4b_human Serine/threonine-protein kinase PRP4 homolog PRPF4B KIAA0536 PRP4 PRP4H PRP4K PRP4 pre-mRNA-processing factor 4 homolog PRP4 kinase protein protein human Homo sapiens Human MAAAETQSLREQPEMEDANSEKSINEENGEVSEDQSQNKHSRHKKKKHKHRSKHKKHKHSSEEDKDKKHKHKHKHKKHKRKEIIDASDKEGMSPAKRTKLDDLALLEDLEKQRALIKAELDNELMEGKVQSGMGLILQGYESGSEEEGEIHEKARNGNRSSTRSSSTKGKLELVDNKITTKKRSKSRSKERTRHRSDKKKSKGGIEIVKEKTTRSKSKERKKSKSPSKRSKSQDQARKSKSPTLRRRSQEKIGKARSPTDDKVKIEDKSKSKDRKKSPIINESRSRDRGKKSRSPVDLRGKSKDRRSRSKERKSKRSETDKEKKPIKSPSKDASSGKENRSPSRRPGRSPKRRSLSPKPRDKSRRSRSPLLNDRRSKQSKSPSRTLSPGRRAKSRSLERKRREPERRRLSSPRTRPRDDILSRRERSKDASPINRWSPTRRRSRSPIRRRSRSPLRRSRSPRRRSRSPRRRDRGRRSRSRLRRRSRSRGGRRRRSRSKVKEDKFKGSLSEGMKVEQESSSDDNLEDFDVEEEDEEALIEQRRIQRQAIVQKYKYLAEDSNMSVPSEPSSPQSSTRTRSPSPDDILERVAADVKEYERENVDTFEASVKAKHNLMTVEQNNGSSQKKLLAPDMFTESDDMFAAYFDSARLRAAGIGKDFKENPNLRDNWTDAEGYYRVNIGEVLDKRYNVYGYTGQGVFSNVVRARDNARANQEVAVKIIRNNELMQKTGLKELEFLKKLNDADPDDKFHCLRLFRHFYHKQHLCLVFEPLSMNLREVLKKYGKDVGLHIKAVRSYSQQLFLALKLLKRCNILHADIKPDNILVNESKTILKLCDFGSASHVADNDITPYLVSRFYRAPEIIIGKSYDYGIDMWSVGCTLYELYTGKILFPGKTNNHMLKLAMDLKGKMPNKMIRKGVFKDQHFDQNLNFMYIEVDKVTEREKVTVMSTINPTKDLLADLIGCQRLPEDQRKKVHQLKDLLDQILMLDPAKRISINQALQHAFIQEKI klf13_human Krueppel-like factor 13 KLF13 BTEB3 NSLP1 Transcription factor BTEB3 Basic transcription element-binding protein 3 RANTES factor of late activated T-lymphocytes 1 Transcription factor NSLP1 Novel Sp1-like zinc finger transcription factor 1 protein protein human Homo sapiens Human MAAAAYVDHFAAECLVSMSSRAVVHGPREGPESRPEGAAVAATPTLPRVEERRDGKDSASLFVVARILADLNQQAPAPAPAERREGAAARKARTPCRLPPPAPEPTSPGAEGAAAAPPSPAWSEPEPEAGLEPEREPGPAGSGEPGLRQRVRRGRSRADLESPQRKHKCHYAGCEKVYGKSSHLKAHLRTHTGERPFACSWQDCNKKFARSDELARHYRTHTGEKKFSCPICEKRFMRSDHLTKHARRHANFHPGMLQRRGGGSRTGSLSDYSRSDASSPTISPASSP nlk_human Serine/threonine-protein kinase NLK NLK LAK1 Nemo-like kinase Protein LAK1 protein protein human Homo sapiens Human MSLCGARANAKMMAAYNGGTSAAAAGHHHHHHHHLPHLPPPHLHHHHHPQHHLHPGSAAAVHPVQQHTSSAAAAAAAAAAAAAMLNPGQQQPYFPSPAPGQAPGPAAAAPAQVQAAAAATVKAHHHQHSHHPQQQLDIEPDRPIGYGAFGVVWSVTDPRDGKRVALKKMPNVFQNLVSCKRVFRELKMLCFFKHDNVLSALDILQPPHIDYFEEIYVVTELMQSDLHKIIVSPQPLSSDHVKVFLYQILRGLKYLHSAGILHRDIKPGNLLVNSNCVLKICDFGLARVEELDESRHMTQEVVTQYYRAPEILMGSRHYSNAIDIWSVGCIFAELLGRRILFQAQSPIQQLDLITDLLGTPSLEAMRTACEGAKAHILRGPHKQPSLPVLYTLSSQATHEAVHLLCRMLVFDPSKRISAKDALAHPYLDEGRLRYHTCMCKCCFSTSTGRVYTSDFEPVTNPKFDDTFEKNLSSVRQVKEIIHQFILEQQKGNRVPLCINPQSAAFKSFISSTVAQPSEMPPSPLVWE a_b_ccl5 promoter A/B site of the CCL5 promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human AATTCGCTATTTTGGAAACTCCCCTTAGGGGATGCCCCTCAACTGCG prpf4b-1 Autophosphorylation of PRPF4B 609527 N/A 609533 putative self putative self putative self putative self chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 phosphorylation phosphorylation reaction phosphorylation false true false Fig. 3A prpf4b-klf13-2 Phosphorylation of KLF13 by PRPF4B 609527 N/A 609533 enzyme enzyme unspecified role unspecified role chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 N/A 609534 enzyme target enzyme target substrate substrate unspecified role unspecified role region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false ecobb Escherichia coli (strain B / BL21) phosphorylation phosphorylation reaction phosphorylation false false false Fig. 3A nlk-1 Autophosphorylation of NLK 609527 N/A 609535 putative self putative self putative self putative self chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 phosphorylation phosphorylation reaction phosphorylation false true false Fig. 3A klf13-prpf4b-1 Interaction between KLF13 and PRPF4B identified by Y2H 609528 N/A 609534 unspecified role unspecified role bait bait N/A 609533 unspecified role unspecified role prey prey physical association physical association false false false klf13-prpf4b-2 Interaction between KLF13 and PRPF4B identified by coimmunoprecipitation 609529 N/A 609533 unspecified role unspecified role bait bait region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 609534 unspecified role unspecified role prey prey physical association physical association false false false 1A klf13-prpf4b-3 Interaction between KLF13 and PRPF4B identified by coimmunoprecipitation 609530 N/A 609534 unspecified role unspecified role bait bait N/A 609533 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 1B klf13-ccl5_dna-1 Binding of KLF13 to the CCL5 promoter region 609531 N/A 609534 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecobb Escherichia coli (strain B / BL21) N/A 609536 unspecified role unspecified role neutral component neutral component direct interaction direct interaction false false false Fig. 3B Nucleic acid was radio-labelled. Interaction inhibited by phosphorylation of KLF13 by PRPF4 and super-shifted by addition of anti-KLF13 antibodies. prpf4b-klf13-3 Colocalisation of KLF13 and PRPF4B 609532 N/A 609534 unspecified role unspecified role neutral component neutral component region gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 609533 unspecified role unspecified role neutral component neutral component region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false colocalization colocalization false false false Fig. 5