IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ kovalenko-1997-2 A novel nucleic acid-binding protein that interacts with human rad51 recombinase. yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu cDNA library from HeLa S3 cells Nucleic Acids Res. (0305-1048) 1997 kovalenko-1997-1 A novel nucleic acid-binding protein that interacts with human rad51 recombinase. yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu cDNA library from HeLa S3 cells Nucleic Acids Res. (0305-1048) 1997 kovalenko-1997-4 A novel nucleic acid-binding protein that interacts with human rad51 recombinase. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu cDNA library from HeLa S3 cells Nucleic Acids Res. (0305-1048) 1997 kovalenko-1997-3 A novel nucleic acid-binding protein that interacts with human rad51 recombinase. in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu cDNA library from HeLa S3 cells Nucleic Acids Res. (0305-1048) 1997 q96b01-2 RAD51-associated protein 1 RAD51AP1 PIR51 RAD51-interacting protein protein protein human Homo sapiens Human MVRPVRHKKPVNYSQFDHSDSDDDFVSATVPLNKKSRTAPKELKQDKPKPNLNNLRKEEIPVQEKTPKKRMALDDKLYQRDLEVALALSVKELPTVTTNVQNSQDKSIEKHGSSKIETMNKSPHISNCSVASDYLDLDKITVEDDVGGVQGKRKAASKAAAQQRKILLEGSDGDSANDTEPDFAPGEDSEDDSDFCESEDNDEDFSMRKSKVKEIKKKEVKVKSPVEKKEKKSKSKCNALVTSVDSAPAAVKSESQSLPKKVSLSSDTTRKPLEIRSPSAESKKPKWVPPAASGGSRSSSSPLVVVSVKSPNQSLRLGLSRLARVKPLHPNATST Ref.3 (AAH05973) sequence differs from that shown due to a frameshift in position 59 rad51_human DNA repair protein RAD51 homolog 1 RAD51 RAD51A RECA RAD51 homolog A protein protein human Homo sapiens Human MAMQMQLEANADTSVEEESFGPQPISRLEQCGINANDVKKLEEAGFHTVEAVAYAPKKELINIKGISEAKADKILAEAAKLVPMGFTTATEFHQRRSEIIQITTGSKELDKLLQGGIETGSITEMFGEFRTGKTQICHTLAVTCQLPIDRGGGEGKAMYIDTEGTFRPERLLAVAERYGLSGSDVLDNVAYARAFNTDHQTQLLYQASAMMVESRYALLIVDSATALYRTDYSGRGELSARQMHLARFLRMLLRLADEFGVAVVITNQVVAQVDGAAMFAADPKKPIGGNIIAHASTTRLYLRKGRGETRICKIYDSPCLPEAEAMFAINADGVGDAKD q96b01-3 RAD51-associated protein 1 RAD51AP1 PIR51 RAD51-interacting protein protein protein human Homo sapiens Human MVRPVRHKKPVNYSQFDHSDSDDDFVSATVPLNKKSRTAPKELKQDKPKPNLNNLRKEEIPVQEKTPKKRLPEGTFSIPASAVPCTKMALDDKLYQRDLEVALALSVKELPTVTTNVQNSQDKSIEKHGSSKIETMNKSPHISNCSVASDYLDLDKITVEDDVGGVQGKRKAASKAAAQQRKILLEGSDGDSANDTEPDFAPGEDSEDDSDFCESEDNDEDFSMRKSKVKEIKKKEVKVKSPVEKKEKKSKSKCNALAASGGSRSSSSPLVVVSVKSPNQSLRLGLSRLARVKPLHPNATST w16 oligonucleotide ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) TTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGTAGCTCAACATGTTTTAAATATGCAA q96b01-1 RAD51-associated protein 1 RAD51AP1 PIR51 RAD51-interacting protein protein protein human Homo sapiens Human MVRPVRHKKPVNYSQFDHSDSDDDFVSATVPLNKKSRTAPKELKQDKPKPNLNNLRKEEIPVQEKTPKKRLPEGTFSIPASAVPCTKMALDDKLYQRDLEVALALSVKELPTVTTNVQNSQDKSIEKHGSSKIETMNKSPHISNCSVASDYLDLDKITVEDDVGGVQGKRKAASKAAAQQRKILLEGSDGDSANDTEPDFAPGEDSEDDSDFCESEDNDEDFSMRKSKVKEIKKKEVKVKSPVEKKEKKSKSKCNALVTSVDSAPAAVKSESQSLPKKVSLSSDTTRKPLEIRSPSAESKKPKWVPPAASGGSRSSSSPLVVVSVKSPNQSLRLGLSRLARVKPLHPNATST No experimental confirmation available rad51-pir51-2 573159 N/A 573163 unspecified role unspecified role prey prey N/A 573164 unspecified role unspecified role bait bait physical association physical association false false false table 1 rad51-pir51-3 573159 N/A 573164 unspecified role unspecified role bait bait N/A 573165 unspecified role unspecified role prey prey physical association physical association false false false table 1 The deletion shown by the authors is longer encompassing AA 196-307 in the parent entry. rad51-pir51-4 573159 N/A 573163 unspecified role unspecified role bait bait N/A 573164 unspecified role unspecified role prey prey physical association physical association false false false table 1 rad51-pir51-5 573159 N/A 573164 unspecified role unspecified role prey prey N/A 573165 unspecified role unspecified role bait bait physical association physical association false false false table 1 The deletion shown by the authors is longer encompassing AA 196-307 in the parent entry. rad51-rad51-6 573159 N/A 573164 unspecified role unspecified role bait bait N/A 573164 unspecified role unspecified role prey prey physical association physical association false false false table 1 rad51-pir51 573160 N/A 573163 unspecified role unspecified role prey prey N/A 573164 unspecified role unspecified role bait bait physical association physical association false false false 1 rad51-pir51-1 573160 N/A 573164 unspecified role unspecified role bait bait N/A 573165 unspecified role unspecified role prey prey physical association physical association false false false 1 The deletion shown by the authors is longer encompassing AA 196-307 in the parent entry. w16-pir5 573161 N/A 573165 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) N/A 573166 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 6 w16-pir5-1 573161 N/A 573166 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 573167 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 6 pir51-rad51 573162 N/A 573164 unspecified role unspecified role prey prey N/A 573165 unspecified role unspecified role bait bait region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) physical association physical association false false false 5