IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ dang-2021-3 in vitro In vitro solution nmr solution state nmr solution state nmr solution nmr predetermined predetermined participant predetermined Dang M., Song J. Virus - Publications including interactions involving viral proteins dbssjx@nus.edu.sg Protein science : a publication of the Protein Society 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus dang-2021-4 in vitro In vitro light microscopy light microscopy predetermined predetermined participant predetermined Dang M., Song J. Virus - Publications including interactions involving viral proteins Differential interference contrast microscopy. Turbidity, the absorption at 600 nm, was also measured. dbssjx@nus.edu.sg Protein science : a publication of the Protein Society 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) ncap_sars2 Nucleoprotein N Nucleocapsid protein protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA s2m rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV CGAGGCCACGCGGAGTACGATCGAGGGTACAG NC_045512v2:29733-29764 atp-n-2 4106313 N/A 4106315 unspecified role unspecified role neutral component neutral component purified purified chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4106316 unspecified role unspecified role neutral component neutral component purified purified CTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region 15n label 15n label 15N N15 15N N15 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) Stoichiometry: 2.0 direct interaction direct interaction false false false 4106313 1 The average Kd value was calculated from the residue-specific Kd values of 12 residues. atp-n-4 4106313 N/A 4106317 unspecified role unspecified role neutral component neutral component synthetic construct synthetic construct N/A 4106315 inhibitor inhibitor neutral component neutral component purified purified chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4106316 unspecified role unspecified role neutral component neutral component purified purified region 15n label 15n label 15N N15 15N N15 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false NTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 3B, Supp. figure 5 n-s2m-1 4106313 N/A 4106317 unspecified role unspecified role neutral component neutral component synthetic construct synthetic construct N/A 4106316 unspecified role unspecified role neutral component neutral component purified purified NTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region 15n label 15n label 15N N15 15N N15 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 3A n-s2m-2 4106313 N/A 4106317 unspecified role unspecified role neutral component neutral component synthetic construct synthetic construct N/A 4106316 unspecified role unspecified role neutral component neutral component purified purified CTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region 15n label 15n label 15N N15 15N N15 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 4 n-s2m-3 4106313 N/A 4106315 inhibitor inhibitor neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4106317 unspecified role unspecified role neutral component neutral component synthetic construct synthetic construct N/A 4106316 unspecified role unspecified role neutral component neutral component purified purified CTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region 15n label 15n label 15N N15 15N N15 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 4B, Supp. figure 6 n-s2m-4 4106314 N/A 4106317 unspecified role unspecified role neutral component neutral component synthetic construct synthetic construct N/A 4106316 unspecified role unspecified role neutral component neutral component purified purified ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 5, Supp. 7 S2m could biphasically modulate LLPS (liquid–liquid phase separation) of N protein: induction at low ratios and dissolution at high ratios. The N protein sample showed no LLPS in the free state, but LLPS could be induced upon addition of S2m as monitored by turbidity and DIC imaging. n-s2m-5 4106314 N/A 4106315 inhibitor inhibitor neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4106317 unspecified role unspecified role neutral component neutral component synthetic construct synthetic construct N/A 4106316 unspecified role unspecified role neutral component neutral component purified purified ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 5 ATP could completely dissolve liquid droplets of N protein induced by S2m.