IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ yamada-2021-2 human-a_549 Homo sapiens Caucasian lung carcinoma cell line a_549 Human Caucasian lung carcinoma rna-ip rna immunoprecipitation rna-ip qrt-pcr quantitative reverse transcription pcr QRT-PCR Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yamada-2021-5 in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yamada-2021-8 in vitro In vitro rna-ip rna immunoprecipitation rna-ip qrt-pcr quantitative reverse transcription pcr QRT-PCR Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins HPAEpiC and HBEpiC cells; Lung Alveolar epithelial Cells (HPAEpiC) and bronchial epithelial cells (HBEpiC). takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yamada-2021-4 in vitro In vitro atpase assay atpase assay predetermined predetermined participant predetermined Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins The sequence for 3pRNA has been taken from Supp. table 3 for the RNA Pulldown assay as no other sequence is stated. However references quoted for 3pRNA give links to a different sequence: one was found in pmid:19380577 (reference 55, from reference 43 in this publication) -5′-triphosphated single-stranded RNA, GG25, 5′-GGAAACUAAAAGGGAGAAGUGAAAGUG. ATPase activity was measured using a phosphate-release assay with BIOMOL Green reagent. The malachite green formed was quantified by reading the absorbance at 620 nm. takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yamada-2021-1 human-a_549 Homo sapiens Caucasian lung carcinoma cell line a_549 Human Caucasian lung carcinoma anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yamada-2021-3 human-epithelium Homo sapiens epithelium/epithelial cells epithelium Epithelium [epithelial cells] rna-ip rna immunoprecipitation rna-ip qrt-pcr quantitative reverse transcription pcr QRT-PCR Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins HPAEpiC and HBEpiC cells; Lung Alveolar epithelial Cells (HPAEpiC) and bronchial epithelial cells (HBEpiC). takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yamada-2021-6 human-a_549 Homo sapiens Caucasian lung carcinoma cell line a_549 Human Caucasian lung carcinoma nuclease footprinting nuclease footprinting qrt-pcr quantitative reverse transcription pcr QRT-PCR Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins Nuclease Protection Assay:Cells were IP-ed using an anti-RIG1 antibody. Protein binding to specific RNA sequences prevents hybridization of added DNA oligonucleotide, thereby protecting the RNA molecule from endonucleolytic cleavage. takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yamada-2021-7 human-a_549 Homo sapiens Caucasian lung carcinoma cell line a_549 Human Caucasian lung carcinoma crosslink cross-linking study crosslink western blot western blot Immuno blot Immuno blot Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins "VIR-CLASP":Viral cross-linking and solid-phase purification. Cells were infected with 4-thiouridine (4SU)-labeled SARS-CoV-2, irradiated with UV light, followed by Solid-phase capture of these complexes with magnetic SPRI beads, which selectively immobilize nucleic acids. This leads to purification of total RNA but only proteins covalently crosslinked to the 4SU-labeled viral RNA. Crosslinked proteins were identified by Western blot. takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yamada-2021-9 human-calu_3 Homo sapiens lung adenocarcinoma calu_3 male caucasian lung adenocarcinoma ATCC number - HTB-55 rna-ip rna immunoprecipitation rna-ip qrt-pcr quantitative reverse transcription pcr QRT-PCR Yamada T., Sato S., Sotoyama Y., Orba Y., Sawa H., Yamauchi H., Sasaki M., Takaoka A. Virus - Publications including interactions involving viral proteins HPAEpiC and HBEpiC cells; Lung Alveolar epithelial Cells (HPAEpiC) and bronchial epithelial cells (HBEpiC). takaoka@igm.hokudai.ac.jp Nature immunology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus ddx58_human Antiviral innate immune response receptor RIG-I DEAD box protein 58 Retinoic acid-inducible gene 1 protein DDX58 Probable ATP-dependent RNA helicase DDX58 Retinoic acid-inducible gene I protein RIG-I-like receptor 1 protein protein human Homo sapiens Human MTTEQRRSLQAFQDYIRKTLDPTYILSYMAPWFREEEVQYIQAEKNNKGPMEAATLFLKFLLELQEEGWFRGFLDALDHAGYSGLYEAIESWDFKKIEKLEEYRLLLKRLQPEFKTRIIPTDIISDLSECLINQECEEILQICSTKGMMAGAEKLVECLLRSDKENWPKTLKLALEKERNKFSELWIVEKGIKDVETEDLEDKMETSDIQIFYQEDPECQNLSENSCPPSEVSDTNLYSPFKPRNYQLELALPAMKGKNTIICAPTGCGKTFVSLLICEHHLKKFPQGQKGKVVFFANQIPVYEQQKSVFSKYFERHGYRVTGISGATAENVPVEQIVENNDIIILTPQILVNNLKKGTIPSLSIFTLMIFDECHNTSKQHPYNMIMFNYLDQKLGGSSGPLPQVIGLTASVGVGDAKNTDEALDYICKLCASLDASVIATVKHNLEELEQVVYKPQKFFRKVESRISDKFKYIIAQLMRDTESLAKRICKDLENLSQIQNREFGTQKYEQWIVTVQKACMVFQMPDKDEESRICKALFLYTSHLRKYNDALIISEHARMKDALDYLKDFFSNVRAAGFDEIEQDLTQRFEEKLQELESVSRDPSNENPKLEDLCFILQEEYHLNPETITILFVKTRALVDALKNWIEGNPKLSFLKPGILTGRGKTNQNTGMTLPAQKCILDAFKASGDHNILIATSVADEGIDIAQCNLVILYEYVGNVIKMIQTRGRGRARGSKCFLLTSNAGVIEKEQINMYKEKMMNDSILRLQTWDEAVFREKILHIQTHEKFIRDSQEKPKPVPDKENKKLLCRKCKALACYTADVRVIEECHYTVLGDAFKECFVSRPHPKPKQFSSFEKRAKIFCARQNCSHDWGIHVKYKTFEIPVIKIESFVVEDIATGVQTLYSKWKDFHFEKIPFDPAEMSK nc_045512.2 rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV p0dtd1-pro_0000449629 RNA-directed RNA polymerase nsp12 rep ORF1ab polyprotein 1a-1b protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV SADAQSFLNRVCGVSAARLTPCGTGTSTDVVYRAFDIYNDKVAGFAKFLKTNCCRFQEKDEDDNLIDSYFVVKRHTFSNYQHEETIYNLLKDCPAVAKHDFFKFRIDGDMVPHISRQRLTKYTMADLVYALRHFDEGNCDTLKEILVTYNCCDDDYFNKKDWYDFVENPDILRVYANLGERVRQALLKTVQFCDAMRNAGIVGVLTLDNQDLNGNWYDFGDFIQTTPGSGVPVVDSYYSLLMPILTLTRALTAESHVDTDLTKPYIKWDLLKYDFTEERLKLFDRYFKYWDQTYHPNCVNCLDDRCILHCANFNVLFSTVFPPTSFGPLVRKIFVDGVPFVVSTGYHFRELGVVHNQDVNLHSSRLSFKELLVYAADPAMHAASGNLLLDKRTTCFSVAALTNNVAFQTVKPGNFNKDFYDFAVSKGFFKEGSSVELKHFFFAQDGNAAISDYDYYRYNLPTMCDIRQLLFVVEVVDKYFDCYDGGCINANQVIVNNLDKSAGFPFNKWGKARLYYDSMSYEDQDALFAYTKRNVIPTITQMNLKYAISAKNRARTVAGVSICSTMTNRQFHQKLLKSIAATRGATVVIGTSKFYGGWHNMLKTVYSDVENPHLMGWDYPKCDRAMPNMLRIMASLVLARKHTTCCSLSHRFYRLANECAQVLSEMVMCGGSLYVKPGGTSSGDATTAYANSVFNICQAVTANVNALLSTDGNKIADKYVRNLQHRLYECLYRNRDVDTDFVNEFYAYLRKHFSMMILSDDAVVCFNSTYASQGLVASIKNFKSVLYYQNNVFMSEAKCWTETDLTKGPHEFCSQHTMLVKQGDDYVYLPYPDPSRILGAGCFVDDIVKTDGTLMIERFVSLAIDAYPLTKHPNQEYADVFHLYLQYIRKLHDELTGHMLDMYSVMLTNDNTSRYWEPEFYEAMYTPHTVLQ 4393 5324 ifih1_human Interferon-induced helicase C domain-containing protein 1 Helicase with 2 CARD domains Interferon-induced with helicase C domain protein 1 Melanoma differentiation-associated protein 5 Murabutide down-regulated protein RNA helicase-DEAD box protein 116 RIG-I-like receptor 2 IFIH1 MDA5 RH116 Clinically amyopathic dermatomyositis autoantigen 140 kDa protein protein human Homo sapiens Human MSNGYSTDENFRYLISCFRARVKMYIQVEPVLDYLTFLPAEVKEQIQRTVATSGNMQAVELLLSTLEKGVWHLGWTREFVEALRRTGSPLAARYMNPELTDLPSPSFENAHDEYLQLLNLLQPTLVDKLLVRDVLDKCMEEELLTIEDRNRIAAAENNGNESGVRELLKRIVQKENWFSAFLNVLRQTGNNELVQELTGSDCSESNAEIENLSQVDGPQVEEQLLSTTVQPNLEKEVWGMENNSSESSFADSSVVSESDTSLAEGSVSCLDESLGHNSNMGSDSGTMGSDSDEENVAARASPEPELQLRPYQMEVAQPALEGKNIIICLPTGSGKTRVAVYIAKDHLDKKKKASEPGKVIVLVNKVLLVEQLFRKEFQPFLKKWYRVIGLSGDTQLKISFPEVVKSCDIIISTAQILENSLLNLENGEDAGVQLSDFSLIIIDECHHTNKEAVYNNIMRHYLMQKLKNNRLKKENKPVIPLPQILGLTASPGVGGATKQAKAEEHILKLCANLDAFTIKTVKENLDQLKNQIQEPCKKFAIADATREDPFKEKLLEIMTRIQTYCQMSPMSDFGTQPYEQWAIQMEKKAAKEGNRKERVCAEHLRKYNEALQINDTIRMIDAYTHLETFYNEEKDKKFAVIEDDSDEGGDDEYCDGDEDEDDLKKPLKLDETDRFLMTLFFENNKMLKRLAENPEYENEKLTKLRNTIMEQYTRTEESARGIIFTKTRQSAYALSQWITENEKFAEVGVKAHHLIGAGHSSEFKPMTQNEQKEVISKFRTGKINLLIATTVAEEGLDIKECNIVIRYGLVTNEIAMVQARGRARADESTYVLVAHSGSGVIEHETVNDFREKMMYKAIHCVQNMKPEEYAHKILELQMQSIMEKKMKTKRNIAKHYKNNPSLITFLCKNCSVLACSGEDIHVIEKMHHVNMTPEFKELYIVRENKALQKKCADYQINGEIICKCGQAWGTMMVHKGLDLPCLKIRNFVVVFKNNSTKKQYKKWVELPITFPNLDYSECCLFSDED 3d-protein_region-emcv ds rna ds rna double stranded ribonucleic acid emcv Encephalomyocarditis virus GACGCTTGAAGACGTTGTCTTCTTA 7445-7655 3’utr-sense rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV TAATACGACTCACTATAGGGGACCACACAAGGCAGATGG residues 29543-29561 3prna rna ribonucleic acid RNA rna in vitro In vitro TAATACGACTCACTATAGGGAAACTAAAAGGGAGAAGTGAAAGTG poly(i:c) poly(I:C) 5'-Inosinic acid, homopolymer, complex with 5'-cytidylic acid homopolymer (1:1) PI:C Poly C poly I Poly I-C poly I:C Poly I:poly C Poly IC Poly rI:poly rC Poly(cytidylic acid)-poly(inosinic acid) Poly(I).poly(C) Poly(I).poly(C) complex poly(I).poly(C) Poly(I+C) Poly(rI).(rC) Poly(rI).poly(rC) Polycytidylic-polyinosinic acid Polyinosinic acid:polycytidylic acid Polyinosinic-polycytidylic acid polyinosinic:polycytidylic acid Polyriboinosinic-polyribocytidylic acid small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) mavs_human Mitochondrial antiviral-signaling protein Interferon beta promoter stimulator protein 1 Virus-induced-signaling adapter CARD adapter inducing interferon beta Putative NF-kappa-B-activating protein 031N MAVS IPS1 KIAA1271 VISA protein protein human Homo sapiens Human MPFAEDKTYKYICRNFSNFCNVDVVEILPYLPCLTARDQDRLRATCTLSGNRDTLWHLFNTLQRRPGWVEYFIAALRGCELVDLADEVASVYQSYQPRTSDRPPDPLEPPSLPAERPGPPTPAAAHSIPYNSCREKEPSYPMPVQETQAPESPGENSEQALQTLSPRAIPRNPDGGPLESSSDLAALSPLTSSGHQEQDTELGSTHTAGATSSLTPSRGPVSPSVSFQPLARSTPRASRLPGPTGSVVSTGTSFSSSSPGLASAGAAEGKQGAESDQAEPIICSSGAEAPANSLPSKVPTTLMPVNTVALKVPANPASVSTVPSKLPTSSKPPGAVPSNALTNPAPSKLPINSTRAGMVPSKVPTSMVLTKVSASTVPTDGSSRNEETPAAPTPAGATGGSSAWLDSSSENRGLGSELSKPGVLASQVDSPFSGCFEDLAISASTSLGMGPCHGPEENEYKSEGTFGIHVAENPSIQLLEGNPGPPADPDGGPRPQADRKFQEREVPCHRPSPGALWLQVAVTGVLVVTLLVVLYRRRLH ddx58-nc_045512.2-1 4056852 N/A 4056861 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 4056862 unspecified role unspecified role prey prey infection infection nsp2_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false +1866 to+1970 physical association physical association false false false 3A, Supp. figure 4E ddx58-nc_045512.2-3 4056852 N/A 4056861 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Helicase Domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false O95786:p.Lys270Ala mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false O95786:p.Gln299Ala mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false N/A 4056862 unspecified role unspecified role prey prey infection infection nsp2_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false +1866 to+1970 physical association physical association false false false 3 B/D rep-nc_045512.2-1 4056852 N/A 4056862 unspecified role unspecified role prey prey infection infection nsp2_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false +1866 to+1970 N/A 4056863 unspecified role unspecified role bait bait infection infection physical association physical association false false false 4 C/D Only seen in RIG-I KO cells, not wild-type. Recombinant RIG-I (O95786). ifih1-3d_protein_emcv-1 4056852 N/A 4056864 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 4056865 unspecified role unspecified role prey prey infection infection 3D_protein_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 7445-7655 physical association physical association false false false Ext.Data figure 3E ifih1-nc_045512.2-2 4056852 N/A 4056864 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 4056862 unspecified role unspecified role prey prey infection infection physical association physical association false false false Extended figure 7B MDA5 preferentially interacts with the negative-strand RNA of the SARS-CoV-2 RNA genome. Assay performed in RIG1 KO cells. nc_045512.2-ddx58-1 4056853 N/A 4056861 unspecified role unspecified role prey prey purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection N/A 4056862 unspecified role unspecified role bait bait purified purified infection infection region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chlae-vero_e6 chlae-vero_e6 cells vero_e6 vero_e6 cell African green monkey kidney epithelial cells epithelium Epithelium [epithelial cells] direct interaction direct interaction false false false 4E 3utr_sense-ddx58-1 4056853 N/A 4056861 unspecified role unspecified role prey prey purified purified O95786:p.Lys888Glu mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection N/A 4056866 unspecified role unspecified role bait bait in vitro translated in vitro translated protein in vitro translated region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 3'UTR-region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 29543-29561 in vitro In vitro direct interaction direct interaction false false false 4E, Supp. 8B 3prna-ddx58-1 4056853 N/A 4056861 unspecified role unspecified role prey prey purified purified O95786:p.Lys888Glu mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection N/A 4056867 unspecified role unspecified role bait bait in vitro translated in vitro translated protein in vitro translated region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false pp-diphosphate rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Supp. 8B 3prna-ddx58-2 4056853 N/A 4056861 unspecified role unspecified role prey prey purified purified O95786:p.Lys888Glu mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection N/A 4056868 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false pp-diphosphate rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Supp. 8B bbbb ddx58-nc_045512.2-5 4056854 N/A 4056861 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level human-epithelium Homo sapiens epithelium/epithelial cells epithelium Epithelium [epithelial cells] N/A 4056866 competitor competitor competitor unspecified role unspecified role in vitro In vitro N/A 4056862 unspecified role unspecified role prey prey infection infection nsp2_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false +1866 to+1970 human-epithelium Homo sapiens epithelium/epithelial cells epithelium Epithelium [epithelial cells] physical association physical association false false false Supp. figure 4 E ddx58-nc_045512.2-6 4056854 N/A 4056861 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level human-a_549 Homo sapiens Caucasian lung carcinoma cell line a_549 Human Caucasian lung carcinoma N/A 4056866 competitor competitor competitor unspecified role unspecified role in vitro In vitro N/A 4056862 unspecified role unspecified role prey prey infection infection nsp2_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false +1866 to+1970 human-a_549 Homo sapiens Caucasian lung carcinoma cell line a_549 Human Caucasian lung carcinoma physical association physical association false false false Supp. figure 4 E ddx58-nc_045512.2-7 4056854 N/A 4056861 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level human-a_549 Homo sapiens Caucasian lung carcinoma cell line a_549 Human Caucasian lung carcinoma N/A 4056866 competitor competitor competitor unspecified role unspecified role in vitro In vitro N/A 4056862 unspecified role unspecified role prey prey infection infection nsp2_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false +1866 to+1970 human-a_549 Homo sapiens Caucasian lung carcinoma cell line a_549 Human Caucasian lung carcinoma physical association physical association false false false Supp. figure 4 E 3prna-atp-2 4056855 N/A 4056861 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection N/A 4056869 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4056867 enzyme regulator enzyme regulator neutral component neutral component pp-diphosphate rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false in vitro In vitro atpase reaction atpase reaction false false false 3F SARS2 RNA did not stimulate RIG-I ATPase. 3prna-atp-1 4056855 N/A 4056861 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection N/A 4056869 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) atpase reaction atpase reaction false false false 3F mavs-ddx58-11 4056856 N/A 4056861 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 4056870 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association false false false 1C This interaction was seen in cells infected with FluV (Influenza virus (strain A/Puerto Rico/8/34)) but not SARS2. ddx58-nc_045512.2-2 4056857 N/A 4056861 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 4056862 unspecified role unspecified role prey prey infection infection nsp2_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false +1866 to+1970 physical association physical association false false false 3A, Supp. figure 4E nc_045512.2-ddx58-2 4056858 N/A 4056861 unspecified role unspecified role bait bait cell lysate cell lysate physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 4056862 unspecified role unspecified role prey prey cell lysate cell lysate infection infection 3-prime UTR regions, PK5;PK1+2. sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 29620-29631 29637-29648 29649-29660 direct interaction direct interaction false false false 4F ddx58-nc_045512.2-4 4056859 N/A 4056861 unspecified role unspecified role neutral component neutral component physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 4056862 unspecified role unspecified role neutral component neutral component infection infection 4-thio-Uracil rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false direct interaction direct interaction false false false Supp, figure 3F ifih1-nc_045512.2-1 4056860 N/A 4056864 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 4056862 unspecified role unspecified role prey prey infection infection physical association physical association false false false Supp. figure 7A MDA5 preferentially interacts with the negative-strand RNA of the SARS-CoV-2 RNA genome.