IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ bezzi-2021-1 in vitro In vitro cd circular dichroism CD CD cd predetermined predetermined participant predetermined Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins Intramolecular G4s were folded by dissolving RNA oligonucleotides in buffer with different KCl or LiCl concentrations, heating for 5 min at 95 deg.C and slowly cooling to 20 deg.C, prior to recording spectra. For measuring interaction with CNBP the protein was added to G4/RNA folded in the presence of K+, then incubated with CNBP at 37 deg.C and spectra recorded at 20 deg. C. bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus bezzi-2021-2 in vitro In vitro nmr nuclear magnetic resonance NMR NMR nmr predetermined predetermined participant predetermined Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation 1D 1H NMR spectra obtained for each RNA sequence folded in the presence of K+. Coronavirus - Interactions investigated in the context of Coronavirus bezzi-2021-4 in vitro In vitro uv-vis ultraviolet-visible spectroscopy uv-vis predetermined predetermined participant predetermined Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins Thermal Difference Spectroscopy (TDS): This is obtained for a nucleic acid by recording the UV absorbance spectra of the unfolded and folded states at temperatures above and below its melting temperature (Tm). The difference between these two spectra is the TDS; it has a specific shape that is unique for each type of nucleic acid structure. bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus bezzi-2021-5 in vitro In vitro fluorescence spectr classical fluorescence spectroscopy fluorescence spectr predetermined predetermined participant predetermined Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins ThT Fluorescence Assay:RNA oligonucleotides folded in buffer containing were mixed with ThT and loaded into 96-well black microplates. Fluorescence emission measurements were performed. A threshold of 10-fold increase was used for considering evidence of G4 formation. ThT Fluorescence Assay;Thioflavin T (ThT) becomes fluorescent in the presence of most, but not all G4-forming sequences, resulting in a large increase in ThT fluorescence emission. The presence of control duplexes and single strands had a more limited effect on emission. bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus bezzi-2021-3 in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight by sybr molecular weight estimation by sybr staining safe DNA gel stain safe DNA gel stain weight by sybr Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins RNA oligonucleotides used as probes were prefolded by thermal denaturation and slow renaturation in the presence of LiCl or KCl. SYBR Gold stain was used to detect nucleic acid bands. bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus -23,877 (nsp3) NSP3 rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV +644 (nsp1) rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV -13,963 (nsp12) rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV +3467 (nsp3) NSP3 rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV cnbp_human CCHC-type zinc finger nucleic acid binding protein Zinc finger protein 9 CNBP ZNF9 RNF163 Cellular nucleic acid-binding protein protein protein human Homo sapiens Human MSSNECFKCGRSGHWARECPTGGGRGRGMRSRGRGGFTSDRGFQFVSSSLPDICYRCGESGHLAKDCDLQEDACYNCGRGGHIAKDCKEPKREREQCCYNCGKPGHLARDCDHADEQKCYSCGEFGHIQKDCTKVKCYRCGETGHVAINCSKTSEVNCYRCGESGHLARECTIEATA +28,903 (n) rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV promoter/pre-5'utr nras rna ribonucleic acid RNA rna human Homo sapiens Human UGUGGGAGGGGCGGGUCUGGG chr1:114716863-114716883 tht Thioflavin T small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) 23,877 (nsp3)-1 4049882 N/A 4049887 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049887 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2A, Supp. figure 2E PQSs +3467 and -23,877 CD spectra have the typical pattern of peaks associated with parallel G4 structure. K+ +644 (nsp1)-+644 (nsp1)-1 4049882 N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2A, Supp. figure 2A CD spectra also showed peaks associated with parallel G4s, but with a milder increase in the positive peak with increasing [K+]. These G4s are probably less stable or less prone to fold. K+ 23,877 (nsp3)-23,877 (nsp3)-1 4049882 N/A 4049889 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049889 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2A, Supp. figure 2D K+ CD spectra also showed peaks associated with parallel G4s, but with a milder increase in the positive peak with increasing [K+]. These G4s are probably less stable or less prone to fold. +3467 (nsp3)-+3467 (nsp3)-1 4049882 N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2A, Supp. figure 2B PQSs +3467 and -23,877 CD spectra have the typical pattern of peaks associated with parallel G4 structure. K+ (CHEBI:29103) +3467 (nsp3)-+3467 (nsp3)-2 4049882 N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049891 inhibitor inhibitor neutral component neutral component purified purified ecoli Escherichia coli (strain K12) N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) 4049920 4049917 direct interaction direct interaction false false false 3B CNBP caused a distortion and reduction of the characteristic G4 peaks of the spectra of the PQSs +644, +3467, -13,963 and -23,877. +644 (nsp1)-+644 (nsp1)-3 4049882 N/A 4049891 inhibitor inhibitor neutral component neutral component purified purified ecoli Escherichia coli (strain K12) N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) 4049926 4049924 direct interaction direct interaction false false false 3B CNBP caused a distortion and reduction of the characteristic G4 peaks of the spectra of the PQSs +644, +3467, -13,963 and -23,877. cnbp-13,963 (nsp12)-2 4049882 N/A 4049889 unspecified role unspecified role neutral component neutral component −13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049889 unspecified role unspecified role neutral component neutral component −13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049891 inhibitor inhibitor neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 4049931 4049929 direct interaction direct interaction false false false 3B CNBP caused a distortion and reduction of the characteristic G4 peaks of the spectra of the PQSs +644, +3467, -13,963 and -23,877. cnbp-23,877 (nsp3)-2 4049882 N/A 4049891 inhibitor inhibitor neutral component neutral component purified purified ecoli Escherichia coli (strain K12) N/A 4049887 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049887 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) 4049938 4049936 direct interaction direct interaction false false false 3B CNBP caused a distortion and reduction of the characteristic G4 peaks of the spectra of the PQSs +644, +3467, -13,963 and -23,877. +3467-+3467-1 4049883 N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2B 1D 1H NMR showed defined signals around 11-12 ppm, confirming the presence of Hoogsteen bonds and G4 structures. 13,963 (nsp12)-13,963 (nsp12)-1 4049883 N/A 4049889 unspecified role unspecified role neutral component neutral component −13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049889 unspecified role unspecified role neutral component neutral component −13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2B 1D 1H NMR also showed G4 signatures but signals were less intense than those for +3467 and −23,877, suggesting that there is a less amount of G4 probably due to lower stabilities and loose global conformation. +644 (nsp1)-+644 (nsp1)-2 4049883 N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2B 1D 1H NMR also showed G4 signatures but signals were less intense than those for +3467 and −23,877, suggesting that there is a less amount of G4 probably due to lower stabilities and loose global conformation. 23,877 (nsp3)-23,877 (nsp3)-2 4049883 N/A 4049887 unspecified role unspecified role neutral component neutral component −23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049887 unspecified role unspecified role neutral component neutral component −23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2A 1D 1H NMR showed defined signals around 11–12 ppm, confirming the presence of Hoogsteen bonds and G4 structures. 234243-1 4049883 N/A 4049892 unspecified role unspecified role neutral component neutral component 28903-28917 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049892 unspecified role unspecified role neutral component neutral component 28903-28917 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 2B 1D 1H NMR did not show G4 signals in the 11-12 ppm region but showed a clear signal around 13.7 ppm, indicating that this sequence does not form Hoogsteen bonds (i.e., G4 structures) but instead contains Watson-Crick base pairs to some extent. +3467 (nsp3)-+3467 (nsp3)-3 4049884 N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S3 TDS spectra showed the typical G4 signature with two positive peaks around 243 and 273 nm and a negative peak at 295 nm. 23,877 (nsp3)-23,877 (nsp3)-3 4049884 N/A 4049887 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049887 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S3 TDS spectra showed the typical G4 signature with two positive peaks around 243 and 273 nm and a negative peak at 295 nm. 13,963 (nsp12)-13,963 (nsp12)-2 4049884 N/A 4049889 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049889 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S3 TDS spectra showed a less well defined spectrum for the −13,963 PQS as compared to +644, +3,467 and -23,877 PQS. +644 (nsp1)-+644 (nsp1)-4 4049884 N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S3 TDS spectra showed the typical G4 signatures for the PQS +644. +28,903 (n)-+28,903 (n)-1 4049884 N/A 4049892 unspecified role unspecified role neutral component neutral component 28903-28917 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049892 unspecified role unspecified role neutral component neutral component 28903-28917 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S3 A very low signal and poor defined spectrum was seen, which supports the absence of G4 structures and is probably compatible with self-complementary duplex structures. pre_5'utr nras-promoter/pre_5'utr nras-1 4049885 N/A 4049893 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049893 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049894 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S4 NRAS Human RNA oligo -Positive control:> X400 fluorescence Reference 90 (PMID: 17322877) is given for the NRAS Human RNA oligo as a positive control here. The sequence for the only oligo found in that publication has been used here, however the sequence does not lie in the 5' UTR as stated, but in a flanking region ~100 residues upstream of Exon 1 (Transcript: NRAS-201 ENST00000369535.5). +3467 (nsp3)-+3467 (nsp3)-4 4049885 N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049890 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049894 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S4 ThT fluorescence was enhanced above 30-fold for +3467. +644 (nsp1)-+644 (nsp1)-5 4049885 N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049888 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049894 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S4 ThT fluorescence was increased barely above 10-fold. 13,963 (nsp12)-13,963 (nsp12)-3 4049885 N/A 4049890 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049890 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049894 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S4 ThT fluorescence was increased barely above 10-fold. 23,877 (nsp3)-23,877 (nsp3)-4 4049885 N/A 4049890 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049890 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4049894 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Figure S4 ThT fluorescence was enhanced above 50-fold for −23,877. cnbp-13,963 (nsp12)-1 4049886 N/A 4049891 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) N/A 4049889 unspecified role unspecified role bait bait -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 3A Binding of CNBP to PQS -13,963 was less evident, as only mild shifts were observed at high CNBP concentrations. +644 (nsp1)-cnbp-1 4049886 N/A 4049891 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) N/A 4049888 unspecified role unspecified role bait bait 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 3A PQSs +644, +3467 and -23,877 clearly interacted with CNBP +3467 (nsp3)-cnbp-1 4049886 N/A 4049891 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) N/A 4049890 unspecified role unspecified role bait bait 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 3A PQSs +644, +3467 and -23,877 clearly interacted with CNBP cnbp-23,877 (nsp3)-1 4049886 N/A 4049891 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) N/A 4049887 unspecified role unspecified role bait bait -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 3A PQSs +644, +3467 and -23,877 clearly interacted with CNBP