IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ shu-2020-4 in vitro In vitro enzymatic study enzymatic study tag fluorescence tag visualisation by fluorescence tag fluorescence Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Helicase Assay:(Duplex) Nucleic acid unwinding assay. Strand separation was monitored by SDS-PAGE; the HEX (Fluorescein) labeled RNA strand is released from dsRNA in the presence of Nsp13. zhangdy63@hotmail.com,zhouxi@wh.iov.cn Virologica Sinica 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus shu-2020-2 in vitro In vitro atpase assay atpase assay predetermined predetermined participant predetermined Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Phosphate release was measured using a colorimetric method based on phosphate complexation with malachite green and molybdate. zhangdy63@hotmail.com,zhouxi@wh.iov.cn Virologica Sinica 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus shu-2020-1 in vitro In vitro triphosphatase ass nucleoside triphosphatase assay triphosphatase ass predetermined predetermined participant predetermined Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Phosphate release was measured using a colorimetric method based on phosphate complexation with malachite green and molybdate. zhangdy63@hotmail.com,zhouxi@wh.iov.cn Virologica Sinica 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus shu-2020-3 in vitro In vitro gtpase assay gtpase assay GTPase gtp hydrolisis gtp hydrolisis GTPase predetermined predetermined participant predetermined Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Phosphate release was measured using a colorimetric method based on phosphate complexation with malachite green and molybdate. zhangdy63@hotmail.com,zhouxi@wh.iov.cn Virologica Sinica 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus rna_1_long RNA_1_long rna ribonucleic acid RNA rna synthetic construct synthetic construct CAUUAUCGGAUAGUGGAACCUAGCUUCGACUAUCGGAUAAUC rna_2_short RNA-2_short rna ribonucleic acid RNA rna in vitro In vitro AUAGUCGAAGCUAGGUUCCACUAU p0dtd1-pro_0000449630 Helicase nsp13 rep ORF1ab polyprotein 1a-1b protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV AVGACVLCNSQTSLRCGACIRRPFLCCKCCYDHVISTSHKLVLSVNPYVCNAPGCDVTDVTQLYLGGMSYYCKSHKPPISFPLCANGQVFGLYKNTCVGSDNVTDFNAIATCDWTNAGDYILANTCTERLKLFAAETLKATEETFKLSYGIATVREVLSDRELHLSWEVGKPRPPLNRNYVFTGYRVTKNSKVQIGEYTFEKGDYGDAVVYRGTTTYKLNVGDYFVLTSHTVMPLSAPTLVPQEHYVRITGLYPTLNISDEFSSNVANYQKVGMQKYSTLQGPPGTGKSHFAIGLALYYPSARIVYTACSHAAVDALCEKALKYLPIDKCSRIIPARARVECFDKFKVNSTLEQYVFCTVNALPETTADIVVFDEISMATNYDLSVVNARLRAKHYVYIGDPAQLPAPRTLLTKGTLEPEYFNSVCRLMKTIGPDMFLGTCRRCPAEIVDTVSALVYDNKLKAHKDKSAQCFKMFYKGVITHDVSSAINRPQIGVVREFLTRNPAWRKAVFISPYNSQNAVASKILGLPTQTVDSSQGSEYDYVIFTQTTETAHSCNVNRFNVAITRAKVGILCIMSDRDLYDKLQFTSLEIPRRNVATLQ 5325 5925 rna_3_short RNA_3_short rna ribonucleic acid RNA rna in vitro In vitro CGAUAGUCGAAGCUAGGUUCCACUAUCC rna_4_short rna_4_short rna ribonucleic acid RNA rna in vitro In vitro GAUUAUCCGAUAGUCGAAGCUAGG rna_5_short RNA_5_short rna ribonucleic acid RNA rna in vitro In vitro GCUAGGUUCCACUAUCCGAUAAUG bpc BPC small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) ranitidine bismuth citrate Ranitidine bismuth citrate small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) bc BC small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) ctp CTP 5'-CTP CTP Cytidine 5'-triphosphate Cytidine triphosphate CYTIDINE-5'-TRIPHOSPHATE H4ctp cytidine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) PCDQPRRSZKQHHS-XVFCMESISA-N utp UTP 5'-UTP H4utp Uridine 5'-triphosphate uridine 5'-triphosphoric acid Uridine triphosphate UTP uridine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) PGAVKCOVUIYSFO-XVFCMESISA-N gtp guanosine triphosphate - GTP 5'-GTP GTP Guanosine 5'-triphosphate guanosine 5'-triphosphoric acid guanosine triphosphate GUANOSINE-5'-TRIPHOSPHATE H4gtp guanosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) InChI=1/C10H16N5O14P3/c11-10-13-7-4(8(18)14-10)12-2-15(7)9-6(17)5(16)3(27-9)1-26-31(22,23)29-32(24,25)28-30(19,20)21/h2-3,5-6,9,16-17H,1H2,(H,22,23)(H,24,25)(H2,19,20,21)(H3,11,13,14,18)/t3-,5-,6-,9-/m1/s1/f/h14,19-20,22,24H,11H2 rep-rna_2_short-1 3940183 N/A 3940187 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain false whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3940188 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) 3940205 3940203 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 2B-D, (5B), 6 rep-rna_1_long-1 3940183 N/A 3940187 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain false whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3940190 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) 3940214 3940212 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 3 ATP and GTP Efficiency of RNA helix-unwinding by nsp13 was limited in the presence of CTP and UTP. Mg2+ and to a lesser extent Mn2+. rep-rna_1_long-2 3940183 N/A 3940187 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain false whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3940191 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) 3940223 3940221 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 4, no 1 SARS-CoV-2 nsp13 efficiently unwound the RNA helix substrate with 5′-protrusion. rep-rna_1_long-3 3940183 N/A 3940187 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain false whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3940192 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) 3940232 3940230 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 4, no 2 SARS-CoV-2 nsp13 unwound the RNA helix substrate with 3′-protrusion less efficiently. The RNA helix substrate with blunt ends was not unwound at all. rep-rna_1_long-4 3940183 N/A 3940193 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940187 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain false whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3940188 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) 3940242 3940240 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 5B, 6 A-C. bpc-rep-1 3940183 N/A 3940194 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940187 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain false whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3940188 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) 3940252 3940250 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 5B, 6 D-F. bc-rep-1 3940183 N/A 3940195 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940187 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain false whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3940188 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) 3940262 3940260 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 5B BC treatment also effectively inhibited the RNA helicase activity of nsp13, its inhibitory efficiency was in much less than BPC or RBC. atp-rep-10 3940184 N/A 3940196 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) atpase reaction atpase reaction false false false 1 A-D, 5A Optimal ATPase activity was shown in the presence of 2 mmol/L Mg2+. Recombinant SARS-CoV-2 nsp13 could hydrolyze all four types of NTPs, with a preference for ATP and GTP. Mg2+ atp-rep-11 3940184 N/A 3940194 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940196 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) atpase reaction atpase reaction false false false 5A, 6D atp-bpc-1 3940184 N/A 3940193 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940196 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) atpase reaction atpase reaction false false false 5A, 6A atp-bpc-2 3940184 N/A 3940195 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940196 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) atpase reaction atpase reaction false false false 5A ctp-rep-1 3940185 N/A 3940197 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) triphosphatase react nucleoside triphosphatase reaction triphosphatase react false false false 1A Recombinant SARS-CoV-2 nsp13 could hydrolyze all four types of NTPs, with a preference for ATP and GTP. ctp-rep-2 3940185 N/A 3940198 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) triphosphatase react nucleoside triphosphatase reaction triphosphatase react false false false 1A Recombinant SARS-CoV-2 nsp13 could hydrolyze all four types of NTPs, with a preference for ATP and GTP. gtp-rep-1 3940186 N/A 3940189 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3940199 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) gtpase reaction gtpase reaction false false false 1A Recombinant SARS-CoV-2 nsp13 could hydrolyze all four types of NTPs, with a preference for ATP and GTP.