IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ zhang-1995-1 Molecular cloning and characterization of NF-IL3A, a transcriptional activator of the human interleukin-3 promoter. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Zhang W., Zhang J., Kornuc M., Kwan K., Frank R., Nimer S.D. IBD - Inflammatory bowel disease s-nimer@mskcc.org Mol. Cell. Biol. (0270-7306) 1995 Only protein-protein interactions imex curation zhang-1995-2 Molecular cloning and characterization of NF-IL3A, a transcriptional activator of the human interleukin-3 promoter. in vitro In vitro dnase 1 footprinting DNase I footprinting dnase 1 footprinting nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Zhang W., Zhang J., Kornuc M., Kwan K., Frank R., Nimer S.D. IBD - Inflammatory bowel disease s-nimer@mskcc.org Mol. Cell. Biol. (0270-7306) 1995 Only protein-protein interactions imex curation zhang-1995-3 Molecular cloning and characterization of NF-IL3A, a transcriptional activator of the human interleukin-3 promoter. in vitro In vitro lambda phage lambda phage display lambda phage nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Zhang W., Zhang J., Kornuc M., Kwan K., Frank R., Nimer S.D. IBD - Inflammatory bowel disease The oligonucleotide used for screening contained the IL-3 promoter region ranging from -165 to -128 with a BamHI 5-prime overhang and was concatenated to around 400 basepairs using T4 DNA ligase. s-nimer@mskcc.org Lambda gt11 library containing cDNA from phytohemagglutinin (PHA)-stimulated human T cells Mol. Cell. Biol. (0270-7306) 1995 Only protein-protein interactions imex curation nfil3_human Nuclear factor interleukin-3-regulated protein NFIL3 E4BP4 IL3BP1 E4 promoter-binding protein 4 Interleukin-3 promoter transcriptional activator Interleukin-3-binding protein 1 Transcriptional activator NF-IL3A protein protein human Homo sapiens Human MQLRKMQTVKKEQASLDASSNVDKMMVLNSALTEVSEDSTTGEELLLSEGSVGKNKSSACRRKREFIPDEKKDAMYWEKRRKNNEAAKRSREKRRLNDLVLENKLIALGEENATLKAELLSLKLKFGLISSTAYAQEIQKLSNSTAVYFQDYQTSKSNVSSFVDEHEPSMVSSSCISVIKHSPQSSLSDVSEVSSVEHTQESSVQGSCRSPENKFQIIKQEPMELESYTREPRDDRGSYTASIYQNYMGNSFSGYSHSPPLLQVNRSSSNSPRTSETDDGVVGKSSDGEDEQQVPKGPIHSPVELKHVHATVVKVPEVNSSALPHKLRIKAKAMQIKVEAFDNEFEATQKLSSPIDMTSKRHFELEKHSAPSMVHSSLTPFSVQVTNIQDWSLKSEHWHQKELSGKTQNSFKTGVVEMKDSGYKVSDPENLYLKQGIANLSAEVVSLKRLIATQPISASDSG il3_human_-160/-141_dna-probe Human IL3 gene promoter region -160 to -141 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GTCATGGATGAATAATTACG il3_human_-165/-128_dna-probe Human IL3 gene promoter region -165 to -128 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGAAAGTCATGGATGAATAATTACGTCTGTGGTTTTCT ifng_human_par-site_dna-probe Human IFNG gene promoter PAR consensus site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GTGAAAATACGTAATCCTCA il3_human_-149/-134_dna-probe Human IL3 gene promoter region -149 to -134 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human ATAATTACGTCTGTGG e4_adenovirus_e4bp4-site_dna-probe Adenovirus E4 gene promoter E4BP4 consensus site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) AAGCTTCTAAAAAATGACGTAACGGAAGCTT il3_human_gene Interleukin-3 (IL3) human gene IL3 gene gene human Homo sapiens Human il3-nfil3-3 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774017 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 4 Q16649 increases expression at RNA level of ENSG00000164399 An NF-IL3A-generated gel shift band was also observed in an EMSA with nuclear extracts from MLA144 T cells (Fig. 8), in which NF-IL3A was shown to increase the activity of IL3 promoter constructs; however, since no antibody was used to identify the participant, this experiment was not captured here. il3-il3-5 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774017 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1774017 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 4 il3-il3-1 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774018 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1774017 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 4 il3-ifng-1 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774019 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1774017 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 4 il3-nfil3-1 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774020 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 6 il3-il3-2 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774020 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1774020 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 6 il3-il3-3 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774017 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1774020 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 6 il3-il3-4 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774020 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1774018 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 6 il3-e4-1 1774013 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774021 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1774017 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 4 il3-nfil3-4 1774014 n/a 1774016 unspecified role unspecified role prey prey in vitro In vitro n/a 1774022 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro physical association physical association false false false Fig. 5 The labeled DNA fragment used in this interaction corresponds to the IL3 gene promoter region ranging from -273 to -61. il3-nfil3-2 1774015 n/a 1774016 unspecified role unspecified role prey prey lambd Enterobacteria phage lambda Bacteriophage lambda n/a 1774018 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 1