IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ potter-2013-3 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. in vitro In vitro nucl ac uv crosslink nucleic acid uv cross-linking assay nucl ac uv crosslink western blot western blot Immuno blot Immuno blot Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease Cross-linking was performed with nuclear extracts from LX-2 cells exposed to 1,25-(OH)2D3 (the active form of vitamin D3) (CHEBI:17823) (10 ng/ml) for 24 hours. emezey@jhmi.edu Liver Int. (1478-3223) 2013 Only protein-protein interactions imex curation potter-2013-1 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease The ChIP assay was performed with LX-2 cells exposed to 1,25-(OH)2D3 (the active form of vitamin D3) (CHEBI:17823) (10 nanomolar) for 24 hours. emezey@jhmi.edu Liver Int. (1478-3223) 2013 Only protein-protein interactions imex curation potter-2013-2 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease emezey@jhmi.edu Liver Int. (1478-3223) 2013 Only protein-protein interactions imex curation vdr_human Vitamin D3 receptor 1,25-dihydroxyvitamin D3 receptor Nuclear receptor subfamily 1 group I member 1 VDR NR1I1 protein protein human Homo sapiens Human MEAMAASTSLPDPGDFDRNVPRICGVCGDRATGFHFNAMTCEGCKGFFRRSMKRKALFTCPFNGDCRITKDNRRHCQACRLKRCVDIGMMKEFILTDEEVQRKREMILKRKEEEALKDSLRPKLSEEQQRIIAILLDAHHKTYDPTYSDFCQFRPPVRVNDGGGSHPSRPNSRHTPSFSGDSSSSCSDHCITSSDMMDSSSFSNLDLSEEDSDDPSVTLELSQLSMLPHLADLVSYSIQKVIGFAKMIPGFRDLTSEDQIVLLKSSAIEVIMLRSNESFTMDDMSWTCGNQDYKYRVSDVTKAGHSLELIEPLIKFQVGLKKLNLHEEEHVLLMAICIVSPDRPGVQDAALIEAIQDRLSNTLQTYIRCRHPPPGSHLLYAKMIQKLADLRSLNEEHSKQYRCLSFQPECSMKLTPLVLEVFGNEIS co1a1_human_vdr-site_dna-probe Human CO1A1 gene promoter vitamin D receptor binding motif DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TCACACCTTGGAGGTTTCAACT sp1_human Transcription factor Sp1 SP1 TSFP1 protein protein human Homo sapiens Human MSDQDHSMDEMTAVVKIEKGVGGNNGGNGNGGGAFSQARSSSTGSSSSTGGGGQESQPSPLALLAATCSRIESPNENSNNSQGPSQSGGTGELDLTATQLSQGANGWQIISSSSGATPTSKEQSGSSTNGSNGSESSKNRTVSGGQYVVAAAPNLQNQQVLTGLPGVMPNIQYQVIPQFQTVDGQQLQFAATGAQVQQDGSGQIQIIPGANQQIITNRGSGGNIIAAMPNLLQQAVPLQGLANNVLSGQTQYVTNVPVALNGNITLLPVNSVSAATLTPSSQAVTISSSGSQESGSQPVTSGTTISSASLVSSQASSSSFFTNANSYSTTTTTSNMGIMNFTTSGSSGTNSQGQTPQRVSGLQGSDALNIQQNQTSGGSLQAGQQKEGEQNQQTQQQQILIQPQLVQGGQALQALQAAPLSGQTFTTQAISQETLQNLQLQAVPNSGPIIIRTPTVGPNGQVSWQTLQLQNLQVQNPQAQTITLAPMQGVSLGQTSSSNTTLTPIASAASIPAGTVTVNAAQLSSMPGLQTINLSALGTSGIQVHPIQGLPLAIANAPGDHGAQLGLHGAGGDGIHDDTAGGEEGENSPDAQPQAGRRTRREACTCPYCKDSEGRGSGDPGKKKQHICHIQGCGKVYGKTSHLRAHLRWHTGERPFMCTWSYCGKRFTRSDELQRHKRTHTGEKKFACPECPKRFMRSDHLSKHIKTHQNKKGGPGVALSVGTLPLDSGAGSEGSGTATPSALITTNMVAMEAICPEGIARLANSGINVMQVADLQSINISGNGF rxra_human Retinoic acid receptor RXR-alpha RXRA NR2B1 Retinoid X receptor alpha Nuclear receptor subfamily 2 group B member 1 protein protein human Homo sapiens Human MDTKHFLPLDFSTQVNSSLTSPTGRGSMAAPSLHPSLGPGIGSPGQLHSPISTLSSPINGMGPPFSVISSPMGPHSMSVPTTPTLGFSTGSPQLSSPMNPVSSSEDIKPPLGLNGVLKVPAHPSGNMASFTKHICAICGDRSSGKHYGVYSCEGCKGFFKRTVRKDLTYTCRDNKDCLIDKRQRNRCQYCRYQKCLAMGMKREAVQEERQRGKDRNENEVESTSSANEDMPVERILEAELAVEPKTETYVEANMGLNPSSPNDPVTNICQAADKQLFTLVEWAKRIPHFSELPLDDQVILLRAGWNELLIASFSHRSIAVKDGILLATGLHVHRNSAHSAGVGAIFDRVLTELVSKMRDMQMDKTELGCLRAIVLFNPDSKGLSNPAEVEALREKVYASLEAYCKHKYPEQPGRFAKLLLRLPALRSIGLKCLEHLFFFKLIGDTPIDTFLMEMLEAPHQMT spb_human_nkx2.1-site_dna-probe Human SPB gene promoter transcription factor NKX2.1 binding motif DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CACCTGGAGGGCTCTTCAGAGC co1a1_human_gene Collagen alpha-1(I) chain (CO1A1) human gene gene gene human Homo sapiens Human co1a1-vdr-3 1597203 n/a 1597206 western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 n/a 1597207 autoradiography autoradiography unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 3c co1a1-sp1-2 1597203 n/a 1597207 autoradiography autoradiography unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1597208 western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 physical association physical association false false false Fig. 3c co1a1-rxra-2 1597203 n/a 1597207 autoradiography autoradiography unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1597209 western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 physical association physical association false false false Fig. 3c co1a1-rxra-1 1597203 n/a 1597210 autoradiography autoradiography unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1597209 western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 physical association physical association false false false Fig. 3d co1a1-vdr-1 1597203 n/a 1597210 autoradiography autoradiography unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1597206 western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 physical association physical association false false false Fig. 3d co1a1-sp1-1 1597203 n/a 1597208 western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 n/a 1597210 autoradiography autoradiography unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 3d vdr-co1a1-1 1597204 n/a 1597211 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1597206 unspecified role unspecified role bait bait association association false false false Fig. 3e P11473 decreases expression at RNA level of ENSG00000108821 P11473 and P08047 decreases expression at RNA level of ENSG00000108821 rxra-co1a1-1 1597204 n/a 1597211 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1597209 unspecified role unspecified role bait bait association association false false false Fig. 3e sp1-co1a1-1 1597204 n/a 1597211 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1597208 unspecified role unspecified role bait bait association association false false false Fig. 3e P08047 decreases expression at RNA level of ENSG00000108821 co1a1-vdr-2 1597205 n/a 1597206 unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 n/a 1597207 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false tcacaccttgg-to-tcacacctttt mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 3a, 3b