IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ gilbert-2012-1 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag perox activity tag visualisation by peroxidase activity tag perox activity Gilbert S., Zhang R., Denson L., Moriggl R., Steinbrecher K., Shroyer N., Lin J., Han X. IBD - Inflammatory bowel disease "DNA binding was detected according to LightShift chemiluminescent EMSA kit" (Pierce);this kit requires the use of biotinylated probes - however these are not mentioned in this publication. xiaonan.han@cchmc.org EMBO molecular medicine 2012 Only protein-protein interactions imex curation imex curation tf65_human Transcription factor p65 Nuclear factor NF-kappa-B p65 subunit RELA NFKB3 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 protein protein human Homo sapiens Human MDELFPLIFPAEPAQASGPYVEIIEQPKQRGMRFRYKCEGRSAGSIPGERSTDTTKTHPTIKINGYTGPGTVRISLVTKDPPHRPHPHELVGKDCRDGFYEAELCPDRCIHSFQNLGIQCVKKRDLEQAISQRIQTNNNPFQVPIEEQRGDYDLNAVRLCFQVTVRDPSGRPLRLPPVLSHPIFDNRAPNTAELKICRVNRNSGSCLGGDEIFLLCDKVQKEDIEVYFTGPGWEARGSFSQADVHRQVAIVFRTPPYADPSLQAPVRVSMQLRRPSDRELSEPMEFQYLPDTDDRHRIEEKRKRTYETFKSIMKKSPFSGPTDPRPPPRRIAVPSRSSASVPKPAPQPYPFTSSLSTINYDEFPTMVFPSGQISQASALAPAPPQVLPQAPAPAPAPAMVSALAQAPAPVPVLAPGPPQAVAPPAPKPTQAGEGTLSEALLQLQFDDEDLGALLGNSTDPAVFTDLASVDNSEFQQLLNQGIPVAPHTTEPMLMEYPEAITRLVTGAQRPPDPAPAPLGAPGLPNGLLSGDEDFSSIADMDFSALLSQISS nf-kb_consensus_oligo_probe ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse AGTTGAGGGGACTTTCCCAGGC mlck_ promoter_region_nf-kb_binding_element ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human CAACTTCAGGAGCTTCCCAGCCGAG nf_kb_consensus_oligo_probe-rela-1 1876479 N/A 1876480 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep human-ht_29 Homo sapiens HT-29 caucasian women with colon adenocarcinoma ht_29 HT-29 confirmed as human with IEF of AST, LDH established from the primary tumor of a 44-year-old Caucasian woman with colon adenocarcinoma in 1964; described to be heterotransplantable forming well-differentiated grade I tumors N/A 1876481 unspecified role unspecified role bait bait probable_biotin_tag tag tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 7E P42229 and P51692 decreased the expression at protein level of Q04206 mlck_ promoter_region_nf_kb_binding_element-rela-1 1876479 N/A 1876480 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep human-ht_29 Homo sapiens HT-29 caucasian women with colon adenocarcinoma ht_29 HT-29 confirmed as human with IEF of AST, LDH established from the primary tumor of a 44-year-old Caucasian woman with colon adenocarcinoma in 1964; described to be heterotransplantable forming well-differentiated grade I tumors N/A 1876482 unspecified role unspecified role bait bait probable_biotin_tag tag tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 7F