IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ john-2010-1 in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot John G., Hegarty JP., Yu W., Berg A., Pastor DM., Kelly AA., Wang Y., Poritz LS., Schreiber S., Koltun WA., Lin Z. IBD - Inflammatory bowel disease Nuclear extracts from immortalised B-lymphocytes isolated from peripheral blood. zlin@hmc.psu.edu,wkoltun@hmc.psu.edu Molecular genetics and metabolism 2010 Only protein-protein interactions imex curation imex curation john-2010-3 human-b-cell Homo sapiens B cell b-cell B-cell [B lymphocyte; B-lymphocyte; B cell; B-cells] ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr John G., Hegarty JP., Yu W., Berg A., Pastor DM., Kelly AA., Wang Y., Poritz LS., Schreiber S., Koltun WA., Lin Z. IBD - Inflammatory bowel disease Nuclear extracts from immortalised B-lymphocytes (#033-01-1) isolated from peripheral blood. zlin@hmc.psu.edu,wkoltun@hmc.psu.edu Molecular genetics and metabolism 2010 Only protein-protein interactions imex curation imex curation c25_variant_nkx2-3_probe_ promoter region_at rs11190140_location C25_variant_NKX2-3 promoter region_at rs11190140_location dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AATAGGCGGAAAAGAAGGCTGGCCAA nfac1_human Nuclear factor of activated T-cells, cytoplasmic 1 NFATC1 NFAT2 NFATC NFAT transcription complex cytosolic component protein protein human Homo sapiens Human MPSTSFPVPSKFPLGPAAAVFGRGETLGPAPRAGGTMKSAEEEHYGYASSNVSPALPLPTAHSTLPAPCHNLQTSTPGIIPPADHPSGYGAALDGGPAGYFLSSGHTRPDGAPALESPRIEITSCLGLYHNNNQFFHDVEVEDVLPSSKRSPSTATLSLPSLEAYRDPSCLSPASSLSSRSCNSEASSYESNYSYPYASPQTSPWQSPCVSPKTTDPEEGFPRGLGACTLLGSPRHSPSTSPRASVTEESWLGARSSRPASPCNKRKYSLNGRQPPYSPHHSPTPSPHGSPRVSVTDDSWLGNTTQYTSSAIVAAINALTTDSSLDLGDGVPVKSRKTTLEQPPSVALKVEPVGEDLGSPPPPADFAPEDYSSFQHIRKGGFCDQYLAVPQHPYQWAKPKPLSPTSYMSPTLPALDWQLPSHSGPYELRIEVQPKSHHRAHYETEGSRGAVKASAGGHPIVQLHGYLENEPLMLQLFIGTADDRLLRPHAFYQVHRITGKTVSTTSHEAILSNTKVLEIPLLPENSMRAVIDCAGILKLRNSDIELRKGETDIGRKNTRVRLVFRVHVPQPSGRTLSLQVASNPIECSQRSAQELPLVEKQSTDSYPVVGGKKMVLSGHNFLQDSKVIFVEKAPDGHHVWEMEAKTDRDLCKPNSLVVEIPPFRNQRITSPVHVSFYVCNGKRKRSQYQRFTYLPANVPIIKTEPTDDYEPAPTCGPVSQGLSPLPRPYYSQQLAMPPDPSSCLVAGFPPCPQRSTLMPAAPGVSPKLHDLSPAAYTKGVASPGHCHLGLPQPAGEAPAVQDVPRPVATHPGSPGQPPPALLPQQVSAPPSSSCPPGLEHSLCPSSPSPPLPPATQEPTCLQPCSPACPPATGRPQHLPSTVRRDESPTAGPRLLPEVHEDGSPNLAPIPVTVKREPEELDQLYLDDVNEIIRNDLSSTSTHS nkx23_human_gene Homeobox protein Nkx-2.3 NKX2-3 NKX23 NKX2C gene gene human Homo sapiens Human c25_variant_nkx2_3 promoter region_at rs11190140_location-nfatc1-1 1859844 N/A 1859846 unspecified role unspecified role bait bait purified purified region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false C7-methyl biological feature biological feature certain certain sequence position certain certain certain sequence position certain false Methylation chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1859847 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep human-b-cell Homo sapiens B cell b-cell B-cell [B lymphocyte; B-lymphocyte; B cell; B-cells] physical association physical association false false false 4 Both methylated and non-methylated oligonucleotides bound to NFAT1. c25_variant_nkx2_3_probe_ promoter region_at rs11190140_location-nfatc1-1 1859844 N/A 1859847 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep human-b-cell Homo sapiens B cell b-cell B-cell [B lymphocyte; B-lymphocyte; B cell; B-cells] N/A 1859846 unspecified role unspecified role bait bait purified purified C7T mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false 4-1 Both methylated and non-methylated oligonucleotides bound to NFAT1. The SNP rs11190140 consists of a C to T polymorphism, with the T allele being over-transmitted in IBD populations. nfatc1-nkx2_3-1 1859845 N/A 1859848 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1859847 unspecified role unspecified role bait bait association association false false false 5