IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ li-2011u-5 Positive regulation of hepatic miR-122 expression by HNF4α. human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Li Z.Y., Xi Y., Zhu W.N., Zeng C., Zhang Z.Q., Guo Z.C., Hao D.L., Liu G., Feng L., Chen H.Z., Chen F., Lv X., Liu D.P., Liang C.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The origin of the human HNF4alpha expression construct was derived from PMID:8945471. liudp@pumc.edu.cn J. Hepatol. (0168-8278) 2011 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease li-2011u-1 Positive regulation of hepatic miR-122 expression by HNF4α. human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Li Z.Y., Xi Y., Zhu W.N., Zeng C., Zhang Z.Q., Guo Z.C., Hao D.L., Liu G., Feng L., Chen H.Z., Chen F., Lv X., Liu D.P., Liang C.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The origin of the human HNF4alpha expression construct was derived from PMID:8945471. liudp@pumc.edu.cn J. Hepatol. (0168-8278) 2011 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease li-2011u-2 Positive regulation of hepatic miR-122 expression by HNF4α. human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Li Z.Y., Xi Y., Zhu W.N., Zeng C., Zhang Z.Q., Guo Z.C., Hao D.L., Liu G., Feng L., Chen H.Z., Chen F., Lv X., Liu D.P., Liang C.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The origin of the human HNF4alpha expression construct was derived from PMID:8945471. liudp@pumc.edu.cn J. Hepatol. (0168-8278) 2011 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease li-2011u-3 Positive regulation of hepatic miR-122 expression by HNF4α. human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Li Z.Y., Xi Y., Zhu W.N., Zeng C., Zhang Z.Q., Guo Z.C., Hao D.L., Liu G., Feng L., Chen H.Z., Chen F., Lv X., Liu D.P., Liang C.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The origin of the human HNF4alpha expression construct was derived from PMID:8945471. liudp@pumc.edu.cn J. Hepatol. (0168-8278) 2011 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease li-2011u-4 Positive regulation of hepatic miR-122 expression by HNF4α. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Li Z.Y., Xi Y., Zhu W.N., Zeng C., Zhang Z.Q., Guo Z.C., Hao D.L., Liu G., Feng L., Chen H.Z., Chen F., Lv X., Liu D.P., Liang C.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis A positive control probe was also shown to interact with HNF4alpha in this experiment; however, it was not possible to establish from which gene promoter this probe was derived, hence this interaction is not captured here. The origin of the human HNF4alpha expression construct was derived from PMID:8945471. liudp@pumc.edu.cn J. Hepatol. (0168-8278) 2011 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease rpb1_human DNA-directed RNA polymerase II subunit RPB1 POLR2A DNA-directed RNA polymerase II subunit A DNA-directed RNA polymerase III largest subunit POLR2 RNA-directed RNA polymerase II subunit RPB1 protein protein human Homo sapiens Human MHGGGPPSGDSACPLRTIKRVQFGVLSPDELKRMSVTEGGIKYPETTEGGRPKLGGLMDPRQGVIERTGRCQTCAGNMTECPGHFGHIELAKPVFHVGFLVKTMKVLRCVCFFCSKLLVDSNNPKIKDILAKSKGQPKKRLTHVYDLCKGKNICEGGEEMDNKFGVEQPEGDEDLTKEKGHGGCGRYQPRIRRSGLELYAEWKHVNEDSQEKKILLSPERVHEIFKRISDEECFVLGMEPRYARPEWMIVTVLPVPPLSVRPAVVMQGSARNQDDLTHKLADIVKINNQLRRNEQNGAAAHVIAEDVKLLQFHVATMVDNELPGLPRAMQKSGRPLKSLKQRLKGKEGRVRGNLMGKRVDFSARTVITPDPNLSIDQVGVPRSIAANMTFAEIVTPFNIDRLQELVRRGNSQYPGAKYIIRDNGDRIDLRFHPKPSDLHLQTGYKVERHMCDGDIVIFNRQPTLHKMSMMGHRVRILPWSTFRLNLSVTTPYNADFDGDEMNLHLPQSLETRAEIQELAMVPRMIVTPQSNRPVMGIVQDTLTAVRKFTKRDVFLERGEVMNLLMFLSTWDGKVPQPAILKPRPLWTGKQIFSLIIPGHINCIRTHSTHPDDEDSGPYKHISPGDTKVVVENGELIMGILCKKSLGTSAGSLVHISYLEMGHDITRLFYSNIQTVINNWLLIEGHTIGIGDSIADSKTYQDIQNTIKKAKQDVIEVIEKAHNNELEPTPGNTLRQTFENQVNRILNDARDKTGSSAQKSLSEYNNFKSMVVSGAKGSKINISQVIAVVGQQNVEGKRIPFGFKHRTLPHFIKDDYGPESRGFVENSYLAGLTPTEFFFHAMGGREGLIDTAVKTAETGYIQRRLIKSMESVMVKYDATVRNSINQVVQLRYGEDGLAGESVEFQNLATLKPSNKAFEKKFRFDYTNERALRRTLQEDLVKDVLSNAHIQNELEREFERMREDREVLRVIFPTGDSKVVLPCNLLRMIWNAQKIFHINPRLPSDLHPIKVVEGVKELSKKLVIVNGDDPLSRQAQENATLLFNIHLRSTLCSRRMAEEFRLSGEAFDWLLGEIESKFNQAIAHPGEMVGALAAQSLGEPATQMTLNTFHYAGVSAKNVTLGVPRLKELINISKKPKTPSLTVFLLGQSARDAERAKDILCRLEHTTLRKVTANTAIYYDPNPQSTVVAEDQEWVNVYYEMPDFDVARISPWLLRVELDRKHMTDRKLTMEQIAEKINAGFGDDLNCIFNDDNAEKLVLRIRIMNSDENKMQEEEEVVDKMDDDVFLRCIESNMLTDMTLQGIEQISKVYMHLPQTDNKKKIIITEDGEFKALQEWILETDGVSLMRVLSEKDVDPVRTTSNDIVEIFTVLGIEAVRKALERELYHVISFDGSYVNYRHLALLCDTMTCRGHLMAITRHGVNRQDTGPLMKCSFEETVDVLMEAAAHGESDPMKGVSENIMLGQLAPAGTGCFDLLLDAEKCKYGMEIPTNIPGLGAAGPTGMFFGSAPSPMGGISPAMTPWNQGATPAYGAWSPSVGSGMTPGAAGFSPSAASDASGFSPGYSPAWSPTPGSPGSPGPSSPYIPSPGGAMSPSYSPTSPAYEPRSPGGYTPQSPSYSPTSPSYSPTSPSYSPTSPNYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPNYSPTSPNYTPTSPSYSPTSPSYSPTSPNYTPTSPNYSPTSPSYSPTSPSYSPTSPSYSPSSPRYTPQSPTYTPSSPSYSPSSPSYSPASPKYTPTSPSYSPSSPEYTPTSPKYSPTSPKYSPTSPKYSPTSPTYSPTTPKYSPTSPTYSPTSPVYTPTSPKYSPTSPTYSPTSPKYSPTSPTYSPTSPKGSTYSPTSPGYSPTSPTYSLTSPAISPDDSDEEN g3p_human_gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) human gene gene gene human Homo sapiens Human mir-122_human_gene microRNA-122 (miR-122) human gene gene gene human Homo sapiens Human hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI apoc3_human_gene Apolipoprotein C-III (APOC3) human gene gene gene human Homo sapiens Human mir-122_human_hnf4a-site_dna-probe Human microRNA-122 gene promoter HNF4alpha binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GTTTGACCAAAGGTGGTGCTGACTTAGTGGCCTAAGGTCGTGC polr2a-g3p-3 1763454 n/a 1763459 unspecified role unspecified role bait bait n/a 1763460 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 1 polr2a-mir_122-1 1763454 n/a 1763459 unspecified role unspecified role bait bait n/a 1763461 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 1 hnf4a-mir_122-1 1763455 n/a 1763462 unspecified role unspecified role bait bait n/a 1763461 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 5d P41235 increases expression at RNA level of ENSG00000207778 hnf4a-apoc3-1 1763455 n/a 1763463 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1763462 unspecified role unspecified role bait bait association association false false false Fig. 5d polr2a-g3p-1 1763456 n/a 1763460 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1763459 unspecified role unspecified role bait bait association association false false false Fig. 1 polr2a-g3p-2 1763457 n/a 1763460 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1763459 unspecified role unspecified role bait bait association association false false false Fig. 1 mir_122-hnf4a-1 1763458 n/a 1763462 unspecified role unspecified role prey prey human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma n/a 1763464 unspecified role unspecified role bait bait g29a_c31a_c32g_g36c_g37c_c39a mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 5d