IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ juang-2011-1 Transcriptional activation of the cAMP-responsive modulator promoter in human T cells is regulated by protein phosphatase 2A-mediated dephosphorylation of SP-1 and reflects disease activity in patients with systemic lupus erythematosus. human-t-cell Homo sapiens t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Juang Y.T., Rauen T., Wang Y., Ichinose K., Benedyk K., Tenbrock K., Tsokos G.C. IBD - Inflammatory bowel disease The human PP2A expression construct is described in PMID:10446173. gtsokos@bidmc.harvard.edu J. Biol. Chem. (0021-9258) 2011 Only protein-protein interactions imex curation juang-2011-2 Transcriptional activation of the cAMP-responsive modulator promoter in human T cells is regulated by protein phosphatase 2A-mediated dephosphorylation of SP-1 and reflects disease activity in patients with systemic lupus erythematosus. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Juang Y.T., Rauen T., Wang Y., Ichinose K., Benedyk K., Tenbrock K., Tsokos G.C. IBD - Inflammatory bowel disease The human PP2A expression construct is described in PMID:10446173. gtsokos@bidmc.harvard.edu J. Biol. Chem. (0021-9258) 2011 Only protein-protein interactions imex curation sp1_human Transcription factor Sp1 SP1 TSFP1 protein protein human Homo sapiens Human MSDQDHSMDEMTAVVKIEKGVGGNNGGNGNGGGAFSQARSSSTGSSSSTGGGGQESQPSPLALLAATCSRIESPNENSNNSQGPSQSGGTGELDLTATQLSQGANGWQIISSSSGATPTSKEQSGSSTNGSNGSESSKNRTVSGGQYVVAAAPNLQNQQVLTGLPGVMPNIQYQVIPQFQTVDGQQLQFAATGAQVQQDGSGQIQIIPGANQQIITNRGSGGNIIAAMPNLLQQAVPLQGLANNVLSGQTQYVTNVPVALNGNITLLPVNSVSAATLTPSSQAVTISSSGSQESGSQPVTSGTTISSASLVSSQASSSSFFTNANSYSTTTTTSNMGIMNFTTSGSSGTNSQGQTPQRVSGLQGSDALNIQQNQTSGGSLQAGQQKEGEQNQQTQQQQILIQPQLVQGGQALQALQAAPLSGQTFTTQAISQETLQNLQLQAVPNSGPIIIRTPTVGPNGQVSWQTLQLQNLQVQNPQAQTITLAPMQGVSLGQTSSSNTTLTPIASAASIPAGTVTVNAAQLSSMPGLQTINLSALGTSGIQVHPIQGLPLAIANAPGDHGAQLGLHGAGGDGIHDDTAGGEEGENSPDAQPQAGRRTRREACTCPYCKDSEGRGSGDPGKKKQHICHIQGCGKVYGKTSHLRAHLRWHTGERPFMCTWSYCGKRFTRSDELQRHKRTHTGEKKFACPECPKRFMRSDHLSKHIKTHQNKKGGPGVALSVGTLPLDSGAGSEGSGTATPSALITTNMVAMEAICPEGIARLANSGINVMQVADLQSINISGNGF crem_human_gene cAMP-responsive element modulator (CREM) human gene gene gene human Homo sapiens Human crem_human_sp1-site_dna-probe Human CREM gene promoter SP-1 binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGAGCCGAGACCACGCCACTGCAGCCCAGCCTGGACAGAG sp1-crem-1 1767933 n/a 1767935 unspecified role unspecified role bait bait n/a 1767936 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 4b Increased binding of SP1 to the CREM promoter was observed in T cells from SLE patients compared to healthy controls. P08047 increases expression at RNA level of ENSG00000095794 P67775 and P08047 increases expression at RNA level of ENSG00000095794 PP2A - (PPP2CA) crem-sp1-1 1767934 n/a 1767937 unspecified role unspecified role bait bait atp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1767935 unspecified role unspecified role prey prey human-t-cell Homo sapiens t-cell Peripheral blood T-lymphocytes physical association physical association false false false Fig. 3b