IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ kang-2010-4 in vitro In vitro pull down pull down ms participant Identification by mass spectrometry ms participant Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease xim2002@med.cornell.edu Journal of immunology (Baltimore, Md. : 1950) 2010 Only protein-protein interactions imex curation imex curation kang-2010-5 in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease xim2002@med.cornell.edu Journal of immunology (Baltimore, Md. : 1950) 2010 Only protein-protein interactions imex curation imex curation kang-2010-6 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag visualisation tag visualisation Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease Methods section state that:- EMSA were performed as described by Schreiber et al (11).". However the word "EMSA" is not mentioned in ref. 11, neither does this reference have Schreiber as first or any author. Several sources refer to an EMSA assay in relation to a "Schreiber"; these use 32P labeled probes. Participant detection has been entered here as "Tag Visualisation" as the exact method used is not known. xim2002@med.cornell.edu Journal of immunology (Baltimore, Md. : 1950) 2010 Only protein-protein interactions imex curation imex curation kang-2010-7 human-monocyte Human mononuclear cells monocyte Monocyte, mononuclear cell ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease PBMC (Peripheral blood mononuclear cells)-derived monocytes. xim2002@med.cornell.edu Journal of immunology (Baltimore, Md. : 1950) 2010 Only protein-protein interactions imex curation imex curation 1082a_oligo_il10_promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human TTCTTTGGGAAGGGGAAGTA parp1_human Poly [ADP-ribose] polymerase 1 PARP1 ADPRT PPOL NAD(+) ADP-ribosyltransferase 1 Poly[ADP-ribose] synthase 1 ADP-ribosyltransferase diphtheria toxin-like 1 DNA ADP-ribosyltransferase PARP1 Protein poly-ADP-ribosyltransferase PARP1 protein protein human Homo sapiens Human MAESSDKLYRVEYAKSGRASCKKCSESIPKDSLRMAIMVQSPMFDGKVPHWYHFSCFWKVGHSIRHPDVEVDGFSELRWDDQQKVKKTAEAGGVTGKGQDGIGSKAEKTLGDFAAEYAKSNRSTCKGCMEKIEKGQVRLSKKMVDPEKPQLGMIDRWYHPGCFVKNREELGFRPEYSASQLKGFSLLATEDKEALKKQLPGVKSEGKRKGDEVDGVDEVAKKKSKKEKDKDSKLEKALKAQNDLIWNIKDELKKVCSTNDLKELLIFNKQQVPSGESAILDRVADGMVFGALLPCEECSGQLVFKSDAYYCTGDVTAWTKCMVKTQTPNRKEWVTPKEFREISYLKKLKVKKQDRIFPPETSASVAATPPPSTASAPAAVNSSASADKPLSNMKILTLGKLSRNKDEVKAMIEKLGGKLTGTANKASLCISTKKEVEKMNKKMEEVKEANIRVVSEDFLQDVSASTKSLQELFLAHILSPWGAEVKAEPVEVVAPRGKSGAALSKKSKGQVKEEGINKSEKRMKLTLKGGAAVDPDSGLEHSAHVLEKGGKVFSATLGLVDIVKGTNSYYKLQLLEDDKENRYWIFRSWGRVGTVIGSNKLEQMPSKEDAIEHFMKLYEEKTGNAWHSKNFTKYPKKFYPLEIDYGQDEEAVKKLTVNPGTKSKLPKPVQDLIKMIFDVESMKKAMVEYEIDLQKMPLGKLSKRQIQAAYSILSEVQQAVSQGSSDSQILDLSNRFYTLIPHDFGMKKPPLLNNADSVQAKVEMLDNLLDIEVAYSLLRGGSDDSSKDPIDVNYEKLKTDIKVVDRDSEEAEIIRKYVKNTHATTHNAYDLEVIDIFKIEREGECQRYKPFKQLHNRRLLWHGSRTTNFAGILSQGLRIAPPEAPVTGYMFGKGIYFADMVSKSANYCHTSQGDPIGLILLGEVALGNMYELKHASHISKLPKGKHSVKGLGKTTPDPSANISLDGVDVPLGTGISSGVNDTSLLYNEYIVYDIAQVNLKYLLKLKFNFKTSLW parp1_mouse Poly [ADP-ribose] polymerase 1 Poly[ADP-ribose] synthase 1 NAD(+) ADP-ribosyltransferase 1 Parp1 Adprp Adprt Adprt1 ADP-ribosyltransferase diphtheria toxin-like 1 DNA ADP-ribosyltransferase PARP1 Protein poly-ADP-ribosyltransferase PARP1 protein protein mouse Mus musculus Mouse MAEASERLYRVQYAKSGRASCKKCSESIPKDSLRMAIMVQSPMFDGKVPHWYHFSCFWKVGQSIRHPDVEVDGFSELRWDDQQKVKKTAEAGGVAGKGQDGSGGKAEKTLGDFAAEYAKSNRSMCKGCLEKIEKGQMRLSKKMVDPEKPQLGMIDRWYHPTCFVKKRDELGFRPEYSASQLKGFSLLSAEDKEALKKQLPAIKNEGKRKGDEVDGTDEVAKKKSRKETDKYSKLEKALKAQNELIWNIKDELKKACSTNDLKELLIFNQQQVPSGESAILDRVADGMAFGALLPCKECSGQLVFKSDAYYCTGDVTAWTKCMVKTQNPSRKEWVTPKEFREISYLKKLKVKKQDRIFPPESSAPITVHWPLSVTSAPTAVNSSAPADKPLSNMKILTLGKLSQNKDEAKAVIEKLGGKLTGSANKASLCISIKKEVEKMNKKMEEVKEANIRVVSEDFLQDVSASTKSLQDLLSAHSLSPWGAEVKAEPGEVVAPRGKSAAPSKKSKGCFKEEGVNKSEKRMKLTLKGGAAVDPDSGLEHSAHVLEKGGKVFSATLGLVDIVKGTNSYYKLQLLEDDKESRYWIFRSWGRLGTVIGSNKLEQMPSKEEAVEQFMKLYEEKTGNAWHSKNFTKYPKKFYPLEIDYGQDEEAVKKLTVKPGTKSKLPKPVQELVGMIFDVDSMKKALVEYEIDLQKMPLGKLSRRQIQAAYSILSEVQQPVSQGSSESQILDLSNRFYTLIPHDFGMKKPPLLNNADSVQAKVEMLDNLLDIEVAYSLLRGGSDDSSKDPIDVNYEKLKTDIKVVDRDSEEAEVIRKYVKNTHATTHNAYDLEVIDIFKIEREGESQRYKPFRQLHNRRLLWHGSRTTNFAGILSQGLRIAPPEAPVTGYMFGKGIYFADMVSKSANYCHTSQGDPIGLIMLGEVALGNMYELKHASHISKLPKGKHSVKGLGKTTPDPSASITLEGVEVPLGTGIPSGVNDTALLYNEYIVYDIAQVNLKYLLKLKFNFKTSLW il10_human_gene Interleukin-10 (IL10) human gene gene gene human Homo sapiens Human 1082a_oligo_il10_promoter-parp1-1 1882266 N/A 1882270 unspecified role unspecified role bait bait A11G mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1882271 unspecified role unspecified role prey prey human-mono_mac6 human Acute monocytic leukemia derived cell line Human mono_mac6 physical association physical association false false false 3A 1082a_oligo_il10_promoter-parp1-2 1882266 N/A 1882270 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false A11G mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false N/A 1882272 unspecified role unspecified role prey prey mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 physical association physical association false false false 3Ai 1082a_oligo_il10_promoter-parp1-3 1882267 N/A 1882270 unspecified role unspecified role bait bait A11G mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1882271 unspecified role unspecified role prey prey human-mono_mac6 human Acute monocytic leukemia derived cell line Human mono_mac6 physical association physical association false false false 3B 1082a_oligo_il10_promoter-parp1-4 1882267 N/A 1882270 unspecified role unspecified role bait bait A11G mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1882272 unspecified role unspecified role prey prey mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 physical association physical association false false false 3B 1082a_oligo_il10_promoter-parp1-5 1882268 N/A 1882270 unspecified role unspecified role bait bait possible _tag_or _radiolabel biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1882271 unspecified role unspecified role prey prey human-mono_mac6 human Acute monocytic leukemia derived cell line Human mono_mac6 physical association physical association false false false 3B 1082a_oligo_il10_promoter-parp1-6 1882268 N/A 1882270 unspecified role unspecified role bait bait possible _tag_or _radiolabel tag tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1882272 unspecified role unspecified role prey prey mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 physical association physical association false false false 3B P11103 decreases the expression at RNA level of ENSMUSG00000016529 CHEBI:64042 and CHEBI:16412 increase the expression at protein level of ENSMUSG00000016529 CHEBI:75399 and CHEBI:16412 increase the expression at protein level of ENSMUSG00000016529 CHEBI:42567 and CHEBI:16412 increase the expression at protein level of ENSMUSG00000016529 parp1-il10_human_gene-1 1882269 N/A 1882271 unspecified role unspecified role bait bait N/A 1882273 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 6 B/C "ACs" -apoptotic cells CHEBI:42567 and CHEBI:16412 increase the expression at protein level of ENSG00000136634. CHEBI:75399 and CHEBI:16412 increase the expression at protein level of ENSG00000136634 CHEBI:64042 and CHEBI:16412 increase the expression at protein level of ENSG00000136634