IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ zheng-2010-3 mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease Naturally occurring - Wild-type -CD4+CD25+ (regulatory) mouse T cells, and Induced TReg cells (CD4+CD25- cells treated with anti-CD3/28 + TGF-beta) rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. Nature 2010 Only protein-protein interactions imex curation imex curation zheng-2010-1 in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease Nuclear lysates from unstimulated or stimulated (CD3 and CD28 antibodies, and TGF-beta) CD4+CD25- mouse (Naive) T cells from lymph nodes and spleen. (Stimulated cells become induced TReg cells). rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. Nature 2010 Only protein-protein interactions imex curation imex curation zheng-2010-2 in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Zheng Y., Josefowicz S., Chaudhry A., Peng XP., Forbush K., Rudensky AY. IBD - Inflammatory bowel disease Nuclear extracts from CD4+CD25+ (regulatory) mouse T cells. rudenska@mskcc.org Results from ChIp assays using anti-H3 antibodies have not been included due to lack of antibody specificity. Nature 2010 Only protein-protein interactions imex curation imex curation foxo3_mouse_gene Forkhead box protein O3 Foxo3 Fkhr2 Foxo3a gene gene mouse Mus musculus Mouse foxo3_mouse Forkhead box protein O3 Foxo3 Fkhr2 Foxo3a protein protein mouse Mus musculus Mouse MAEAPASPVPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEDDDEDDEDGGGRASSAMVIGGGVSSTLGSGLLLEDSAMLLAPGGQDLGSGPASAAGALSGGTPTQLQPQQPLPQPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQAAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPILASTELDDVQDDDGPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLAENLMDDLLDNIALPPSQPSPPGGLMQRGSSFPYTAKSSGLGSPTGSFNSTVFGPSSLNSLRQSPMQTIQENRPATFSSVSHYGNQTLQDLLASDSLSHSDVMMTQSDPLMSQASTAVSAQNARRNVMLRNDPMMSFAAQPTQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSDSSSLGSAKHQQQSPASQSMQTLSDSLSGSSLYSASANLPVMGHDKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG ikzf2_mouse_gene Zinc finger protein Helios Ikzf2 Helios Zfpn1a2 Znfn1a2 gene gene mouse Mus musculus Mouse pde3b_mouse_gene Pde3b gene gene mouse Mus musculus Mouse 5ntd_mouse_gene 5'-nucleotidase Nt5e Nt5 Nte gene gene mouse Mus musculus Mouse foxp3_enhancer/cns3_probe_wt CNS3_WT_probe ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse GTGAGGCCCGGGGCCCAGAATGGGGTAAGCAGGGTGGGGTACTTGGGCCTATAGGTGTCGACCTTTACTGTGGCATGTGGCGGGGGGGGGGGGGGGGGCTGGGGCACAGGAAGTGGTTTATGGGTCCCAGGCAAGTCTGACTTATGCAGATATTGCAGGGCCAAGAAAATCCCCACTCTCCAGGCTTCAGAGATTCAAGGCTTTCCCCACCCCTCCCAATCCTCATCCCGATAG rel_mouse Proto-oncogene c-Rel Rel protein protein mouse Mus musculus Mouse MASSGYNPYVEIIEQPRQRGMRFRYKCEGRSAGSIPGERSTDNNRTYPSVQIMNYYGKGKIRITLVTKNDPYKPHPHDLVGKDCRDGYYEAEFGPERRPLFFQNLGIRCVKKKEVKGAIILRISAGINPFNVGEQQLLDIEDCDLNVVRCVFMFFLPDEDGNFTTALPPIVSNPIYDNRAPNTAELRICRVNKNCGSVRGGDEIFLLCDKVQKDDIEVRFVLNDWEARGVFSQADVHRQVAIVFKTPPYCKAILEPVTVKMQLRRPSDQEVSESMDFRYLPDEKDAYGNKSKKQKTTLIFQKLLQDCGHFTEKPRTAPLGSTGEGRFIKKESNLFSHGTVLPEMPRSSGVPGQAEPYYSSCGSISSGLPHHPPAIPSVAHQPTSWPPVTHPTSHPVSTNTLSTFSAGTLSSNSQGILPFLEGPGVSDLSASNSCLYNPDDLARMETPSMSPTDLYSISDVNMLSTRPLSVMAPSTDGMGDTDNPRLVSINLENPSCNARLGPRDLRQLHQMSPASLSAGTSSSSVFVSQSDAFDRSNFSCVDNGLMNEPGLSDDANNPTFVQSSHYSVNTLQSEQLSDPFTYGFFKI il-2 cd28re_probe IL-2 CD28RE ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TAAAGAAATTCCAGA demethylated_foxp3_enhancer/cns2_probe_wt ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TGGGTTTTGCATGGTAGCCAGATGGACGTCACCTACCACATCCGCTAGCACCCACATCACCCTACCTGGGCCTATCCGGCTACAGGATAGACTAGCCACTTCTCGGAACGAAACCTGTGGGGTAGATTATCTGCCCCCTTCTCTTCCTCCTTGTTGCCGATGAAGCCCAATGCATCCGGCCGCCATGACGTCAATGGCAGAAAAATCTGGCCAAGTTCAGGTTGTGACAACAGGGCCCAGATGTAGACCCCGATAGGAAAACATATTCTATGTCCCAGAAACAACCTCCATACAGCTTCTAAGAAACAGTCAAACAGGAACGCCCCAACAGACAGTGCAGGAAGCTGGCTGGCCAGCCCAGCCCTCCAGGTCCCTAGTACCACTAGACAGACCATATCCAATTCAGGTCCTCTTTCTGAGAATGTA pebb_mouse Core-binding factor subunit beta Polyomavirus enhancer-binding protein 2 beta subunit SL3-3 enhancer factor 1 subunit beta SL3/AKV core-binding factor beta subunit Cbfb Pebp2b Pebpb2 protein protein mouse Mus musculus Mouse MPRVVPDQRSKFENEEFFRKLSRECEIKYTGFRDRPHEERQTRFQNACRDGRSEIAFVATGTNLSLQFFPASWQGEQRQTPSREYVDLEREAGKVYLKAPMILNGVCVIWKGWIDLHRLDGMGCLEFDEERAQQEDALAQQAFEEARRRTREFEDRDRSHREEMEARRQQDPSPGSNLGGGDDLKLR foxp3_enhancer/cns2_probe_wt ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TGGGTTTTGCATGGTAGCCAGATGGACGTCACCTACCACATCCGCTAGCACCCACATCACCCTACCTGGGCCTATCCGGCTACAGGATAGACTAGCCACTTCTCGGAACGAAACCTGTGGGGTAGATTATCTGCCCCCTTCTCTTCCTCCTTGTTGCCGATGAAGCCCAATGCATCCGGCCGCCATGACGTCAATGGCAGAAAAATCTGGCCAAGTTCAGGTTGTGACAACAGGGCCCAGATGTAGACCCCGATAGGAAAACATATTCTATGTCCCAGAAACAACCTCCATACAGCTTCTAAGAAACAGTCAAACAGGAACGCCCCAACAGACAGTGCAGGAAGCTGGCTGGCCAGCCCAGCCCTCCAGGTCCCTAGTACCACTAGACAGACCATATCCAATTCAGGTCCTCTTTCTGAGAATGTA runx1_mouse Runt-related transcription factor 1 Runx1 Aml1 Cbfa2 Pebp2ab Acute myeloid leukemia 1 protein Core-binding factor subunit alpha-2 Oncogene AML-1 Polyomavirus enhancer-binding protein 2 alpha B subunit SL3-3 enhancer factor 1 alpha B subunit SL3/AKV core-binding factor alpha B subunit protein protein mouse Mus musculus Mouse MRIPVDASTSRRFTPPSTALSPGKMSEALPLGAPDGGPALASKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDARQIQPSPPWSYDQSYQYLGSITSSSVHPATPISPGRASGMTSLSAELSSRLSTAPDLTAFGDPRQFPTLPSISDPRMHYPGAFTYSPPVTSGIGIGMSAMSSASRYHTYLPPPYPGSSQAQAGPFQTGSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGAALLNPSLPSQSDVVETEGSHSNSPTNMPPARLEEAVWRPY foxo3-1 1855232 N/A 1855235 unspecified role unspecified role prey prey cns2/enhancer_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1855236 unspecified role unspecified role bait bait association association false false false 4E, G, I Induced TRegs (stimulated with anti-CD3/28+TGF-beta) did not demonstrate this interaction. Q08024 increased the binding of Q9WVH4 to ENSMUSG00000048756 foxo3-ikzf2_mouse_gene-1 1855232 N/A 1855237 unspecified role unspecified role prey prey N/A 1855236 unspecified role unspecified role bait bait association association false false false 4Ei,4I Positive control foxo3-pde3b-1 1855232 N/A 1855238 unspecified role unspecified role prey prey N/A 1855236 unspecified role unspecified role bait bait association association false false false 4G Positive control;both naturally occurring and Induced TRegs (stimulated with anti-CD3/28+TGF-beta) demonstrated this interaction. foxo3-nt5e-1 1855232 N/A 1855239 unspecified role unspecified role prey prey N/A 1855236 unspecified role unspecified role bait bait association association false false false 4I Positive control cns3_probe_wt-rel-1 1855233 N/A 1855240 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false cns3_cRel_motif required to bind necessary binding region required to bind range range range range false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1855241 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association false false false 1H CD3/C28 antibodies + TGF-beta:NO Rel binding was seen in the absence of this stimulation. cns3_probe_wt-rel-2 1855233 N/A 1855242 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1855241 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association false false false 1Hi CD3/C28 antibodies + TGF-beta;interaction was seen in the presence AND absence of stimulation. Positive control demethylated_foxp3_enhancer/cns2_probe_wt-cbfb-1 1855233 N/A 1855243 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1855244 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association false false false 4H Binding of the demethylated CNS2 probe to Cbf-beta/Pebb was seen using both naive (CD4+CD25-) and TReg (CD4+CD25+) T cells. foxp3_enhancer/cns3_probe_wt-rel-1 1855234 N/A 1855245 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1855236 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association false false false 4D No binding of the CNS2 probe was seen using naive (CD4+CD25-) T cells. demethylated_foxp3_enhancer/cns2_probe_wt-cbfb-2 1855234 N/A 1855246 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes N/A 1855243 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1855236 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes N/A 1855244 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes association association false false false 4Hi Binding of Cbf-beta/Pebb was seen using methylated and demethylated probes.