IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ xue-2009-1 NF-kappaB regulates thrombin-induced ICAM-1 gene expression in cooperation with NFAT by binding to the intronic NF-kappaB site in the ICAM-1 gene. human-uvec Human Umbilical Vein Endothelial Cells (HUVEC) huvec umbilical_vein_endothelium Umbilical vein endothelial cell [Umbilical vein endothelium] ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Xue J., Thippegowda P.B., Hu G., Bachmaier K., Christman J.W., Malik A.B., Tiruppathi C. IBD - Inflammatory bowel disease Human alpha-thrombin was prepared from homogeneous human prothrombin by activation with Factor Xa, Factor Va, and phospholipid, as specified on the supplier's website (Enzyme Research Laboratories). tiruc@uic.edu Physiol. Genomics (1094-8341) 2009 Only protein-protein interactions imex curation xue-2009-2 NF-kappaB regulates thrombin-induced ICAM-1 gene expression in cooperation with NFAT by binding to the intronic NF-kappaB site in the ICAM-1 gene. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Xue J., Thippegowda P.B., Hu G., Bachmaier K., Christman J.W., Malik A.B., Tiruppathi C. IBD - Inflammatory bowel disease Human alpha-thrombin was prepared from homogeneous human prothrombin by activation with Factor Xa, Factor Va, and phospholipid, as specified on the supplier's website (Enzyme Research Laboratories). tiruc@uic.edu Physiol. Genomics (1094-8341) 2009 Only protein-protein interactions imex curation tf65_human Transcription factor p65 Nuclear factor NF-kappa-B p65 subunit RELA NFKB3 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 protein protein human Homo sapiens Human MDELFPLIFPAEPAQASGPYVEIIEQPKQRGMRFRYKCEGRSAGSIPGERSTDTTKTHPTIKINGYTGPGTVRISLVTKDPPHRPHPHELVGKDCRDGFYEAELCPDRCIHSFQNLGIQCVKKRDLEQAISQRIQTNNNPFQVPIEEQRGDYDLNAVRLCFQVTVRDPSGRPLRLPPVLSHPIFDNRAPNTAELKICRVNRNSGSCLGGDEIFLLCDKVQKEDIEVYFTGPGWEARGSFSQADVHRQVAIVFRTPPYADPSLQAPVRVSMQLRRPSDRELSEPMEFQYLPDTDDRHRIEEKRKRTYETFKSIMKKSPFSGPTDPRPPPRRIAVPSRSSASVPKPAPQPYPFTSSLSTINYDEFPTMVFPSGQISQASALAPAPPQVLPQAPAPAPAPAMVSALAQAPAPVPVLAPGPPQAVAPPAPKPTQAGEGTLSEALLQLQFDDEDLGALLGNSTDPAVFTDLASVDNSEFQQLLNQGIPVAPHTTEPMLMEYPEAITRLVTGAQRPPDPAPAPLGAPGLPNGLLSGDEDFSSIADMDFSALLSQISS icam1_human_gene ICAM1_HUMAN_GENE gene gene human Homo sapiens Human nfac1_human Nuclear factor of activated T-cells, cytoplasmic 1 NFATC1 NFAT2 NFATC NFAT transcription complex cytosolic component protein protein human Homo sapiens Human MPSTSFPVPSKFPLGPAAAVFGRGETLGPAPRAGGTMKSAEEEHYGYASSNVSPALPLPTAHSTLPAPCHNLQTSTPGIIPPADHPSGYGAALDGGPAGYFLSSGHTRPDGAPALESPRIEITSCLGLYHNNNQFFHDVEVEDVLPSSKRSPSTATLSLPSLEAYRDPSCLSPASSLSSRSCNSEASSYESNYSYPYASPQTSPWQSPCVSPKTTDPEEGFPRGLGACTLLGSPRHSPSTSPRASVTEESWLGARSSRPASPCNKRKYSLNGRQPPYSPHHSPTPSPHGSPRVSVTDDSWLGNTTQYTSSAIVAAINALTTDSSLDLGDGVPVKSRKTTLEQPPSVALKVEPVGEDLGSPPPPADFAPEDYSSFQHIRKGGFCDQYLAVPQHPYQWAKPKPLSPTSYMSPTLPALDWQLPSHSGPYELRIEVQPKSHHRAHYETEGSRGAVKASAGGHPIVQLHGYLENEPLMLQLFIGTADDRLLRPHAFYQVHRITGKTVSTTSHEAILSNTKVLEIPLLPENSMRAVIDCAGILKLRNSDIELRKGETDIGRKNTRVRLVFRVHVPQPSGRTLSLQVASNPIECSQRSAQELPLVEKQSTDSYPVVGGKKMVLSGHNFLQDSKVIFVEKAPDGHHVWEMEAKTDRDLCKPNSLVVEIPPFRNQRITSPVHVSFYVCNGKRKRSQYQRFTYLPANVPIIKTEPTDDYEPAPTCGPVSQGLSPLPRPYYSQQLAMPPDPSSCLVAGFPPCPQRSTLMPAAPGVSPKLHDLSPAAYTKGVASPGHCHLGLPQPAGEAPAVQDVPRPVATHPGSPGQPPPALLPQQVSAPPSSSCPPGLEHSLCPSSPSPPLPPATQEPTCLQPCSPACPPATGRPQHLPSTVRRDESPTAGPRLLPEVHEDGSPNLAPIPVTVKREPEELDQLYLDDVNEIIRNDLSSTSTHS icam1_human_nfkb-intron_dna-probe Human ICAM1 gene promoter intronic NF-kappaB sequence DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GTGAGTCGGGGTGGGGATTGCCGTCGGGCCAGT rela-icam1-2 1766537 n/a 1766539 unspecified role unspecified role bait bait n/a 1766540 unspecified role unspecified role prey prey promoter region a -662/-482 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false promoter region c +59/+234 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 1b, 1c alpha-thrombin (P00734) tumor necrosis factor alpha (TNF-alpha) (P01375) Q04206 increases expression at protein level of ENSG00000090339 P01375 indirectly increases expression at protein level of ENSG00000090339 P00734 indirectly increases expression at protein level of ENSG00000090339 P01375 increases binding of Q04206 to ENSG00000090339 P00734 increases binding of Q04206 to ENSG00000090339 The interaction with ICAM1 gene promoter region A (-662/-482) was weak compared to promoter region C (+59/+234) and only occurred after cells were stimulated with alpha-thrombin (P00734) or tumor necrosis factor alpha (TNF-alpha) (P01375). nfatc1-icam1-1 1766537 n/a 1766540 unspecified role unspecified role prey prey promoter region c +59/+234 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1766541 unspecified role unspecified role bait bait association association false false false Fig. 1b alpha-thrombin (P00734) O95644 increases expression at protein level of ENSG00000090339 P00734 increases binding of O95644 to ENSG00000090339 rela-icam1-4 1766537 n/a 1766539 unspecified role unspecified role bait bait n/a 1766540 unspecified role unspecified role prey prey promoter region d +452/+644 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false promoter region b -325/-129 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 1c tumor necrosis factor alpha (TNF-alpha) (P01375) The interaction with ICAM1 gene promoter region B (-325/-129) and D (+452/+644) was relatively weak and only occurred after cells were stimulated with tumor necrosis factor alpha (TNF-alpha) (P01375). icam1-rela-3 1766538 n/a 1766539 unspecified role unspecified role prey prey human-uvec Human Umbilical Vein Endothelial Cells (HUVEC) huvec umbilical_vein_endothelium Umbilical vein endothelial cell [Umbilical vein endothelium] n/a 1766542 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false g14t_g15t_t19g mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 1d alpha-thrombin (P00734) icam1-nfatc1-1 1766538 n/a 1766541 unspecified role unspecified role prey prey human-uvec Human Umbilical Vein Endothelial Cells (HUVEC) huvec umbilical_vein_endothelium Umbilical vein endothelial cell [Umbilical vein endothelium] n/a 1766542 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false g14t_g15t_t19g mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 1d alpha-thrombin (P00734)