DIP Database of Interacting Proteins 611 Young Drive East; Los Angeles CA 90095; USA http://dip.doe-mbi.ucla.edu/ dip@mbi.ucla.edu 611 Young Drive East; Los Angeles CA 90095; USA http://dip.doe-mbi.ucla.edu/ ono-2007-1 mouse-t-cell_cd4+ Mouse CD4 positive T-cell t-cell_cd4+ t cell cd4+ ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp Nature 2007 imex curation Only protein-protein interactions ono-2007-3 in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease The construct that is stated to have been used for EMSA is "pCMV-Tag2-AML1-DN" (DNA binding domain) or "AML1A". From reference 16 and figure 2D (this publication) it has been deduced that AML1-DN/AML1A refers to a shorter isoform of the human protein, of 250 amino acids;it is probably isoform 3 (Q01196-3) as this protein has 250 residues, (but is not Isoform 2 from UniProt entry Q01196 as this isoform (called AML-1A) retains the C-terminal region). There are other human isoforms with a similar length to Q01196-3;however the DNA Binding domain would appear to be retained for most/all isoforms. The species of AML1 (Human) has been verified by a blat of the primers used in Ref 16. shimon@frontier.kyoto-u.ac.jp Nature 2007 imex curation Only protein-protein interactions ono-2007-7 human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti tag coip anti tag coimmunoprecipitation anti tag coip anti tag western anti tag western blot anti tag western Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease The origins of FLAG-tagged AML2 and 3 are not mentioned;hence interactions involving these proteins have not been included. shimon@frontier.kyoto-u.ac.jp Nature 2007 imex curation Only protein-protein interactions ono-2007-2 human-jurkat Homo sapiens jurkat Human T cell leukemia ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp Nature 2007 imex curation Only protein-protein interactions ono-2007-5 in vitro In vitro pull down pull down autoradiography autoradiography Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp Nature 2007 imex curation Only protein-protein interactions ono-2007-4 human-pbmc Human Peripheral Blood Mononuclear cell peripheral_blood_mononuclear_cell Peripheral blood mononuclear cell anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp Nature 2007 imex curation Only protein-protein interactions ono-2007-6 mouse-t-cell_cd4+ Mouse CD4 positive T-cell t-cell_cd4+ t cell cd4+ confocal microscopy confocal microscopy immunocytochemistry immunocytochemistry Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease TReg cells (CD25+) shimon@frontier.kyoto-u.ac.jp Nature 2007 imex curation Only protein-protein interactions runx1_mouse Runt-related transcription factor 1 Runx1 Aml1 Cbfa2 Pebp2ab Acute myeloid leukemia 1 protein Core-binding factor subunit alpha-2 Oncogene AML-1 Polyomavirus enhancer-binding protein 2 alpha B subunit SL3-3 enhancer factor 1 alpha B subunit SL3/AKV core-binding factor alpha B subunit protein protein mouse Mus musculus Mouse MRIPVDASTSRRFTPPSTALSPGKMSEALPLGAPDGGPALASKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDARQIQPSPPWSYDQSYQYLGSITSSSVHPATPISPGRASGMTSLSAELSSRLSTAPDLTAFGDPRQFPTLPSISDPRMHYPGAFTYSPPVTSGIGIGMSAMSSASRYHTYLPPPYPGSSQAQAGPFQTGSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGAALLNPSLPSQSDVVETEGSHSNSPTNMPPARLEEAVWRPY il2_mouse_gene Interleukin-2 Il2 Il-2 gene gene mouse Mus musculus Mouse foxp3_mouse Forkhead box protein P3 Foxp3 Scurfin protein protein mouse Mus musculus Mouse MPNPRPAKPMAPSLALGPSPGVLPSWKTAPKGSELLGTRGSGGPFQGRDLRSGAHTSSSLNPLPPSQLQLPTVPLVMVAPSGARLGPSPHLQALLQDRPHFMHQLSTVDAHAQTPVLQVRPLDNPAMISLPPPSAATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPRSGTPRKDSNLLAAPQGSYPLLANGVCKWPGCEKVFEEPEEFLKHCQADHLLDEKGKAQCLLQREVVQSLEQQLELEKEKLGAMQAHLAGKMALAKAPSVASMDKSSCCIVATSTQGSVLPAWSAPREAPDGGLFAVRRHLWGSHGNSSFPEFFHNMDYFKYHNMRPPFTYATLIRWAILEAPERQRTLNEIYHWFTRMFAYFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDEFEFRKKRSQRPNKCSNPCP il2ra_mouse_gene Interleukin-2 receptor subunit alpha gene gene gene mouse Mus musculus Mouse ctla4_mouse_gene Ctla4 gene gene mouse Mus musculus Mouse tnr18_mouse_gene Tumor necrosis factor receptor superfamily member 18 Tnfrsf18 Gitr gene gene mouse Mus musculus Mouse ifng_mouse_gene Interferon gamma Ifng gene gene mouse Mus musculus Mouse re1_probe_il2_promoter ss dna single stranded deoxyribonucleic acid ss DNA ss dna mouse Mus musculus Mouse TTGCGTTTGTCCACCACAACAGGCTGCTTAC runx1_human Runt-related transcription factor 1 RUNX1 AML1 CBFA2 Core-binding factor subunit alpha-2 Acute myeloid leukemia 1 protein Oncogene AML-1 Polyomavirus enhancer-binding protein 2 alpha B subunit SL3-3 enhancer factor 1 alpha B subunit SL3/AKV core-binding factor alpha B subunit protein protein human Homo sapiens Human MRIPVDASTSRRFTPPSTALSPGKMSEALPLGAPDAGAALAGKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDTRQIQPSPPWSYDQSYQYLGSIASPSVHPATPISPGRASGMTTLSAELSSRLSTAPDLTAFSDPRQFPALPSISDPRMHYPGAFTYSPTPVTSGIGIGMSAMGSATRYHTYLPPPYPGSSQAQGGPFQASSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGSALLNPSLPNQSDVVEAEGSHSNSPTNMAPSARLEEAVWRPY re2_probe_il2_promoter ss dna single stranded deoxyribonucleic acid ss DNA ss dna mouse Mus musculus Mouse TAGAAATGGGGACACCACAGGCAAGCTC re3_probe_il2_promoter ss dna single stranded deoxyribonucleic acid ss DNA ss dna mouse Mus musculus Mouse AAATGGGGTAGGTGTGTGGTGAGGCTTATGTTAA q60591-3 Nuclear factor of activated T-cells, cytoplasmic 2 NFAT pre-existing subunit T-cell transcription factor NFAT1 Nfatc2 Nfat1 Nfatp protein protein mouse Mus musculus Mouse MDVPEPQPDPDGGDGPGHEPGGSPQDELDFSILFDYDYLNPIEEEPIAHKAISSPSGLAYPDDVLDYGLKPCNPLASLSGEPPGRFGEPDSIGFQNFLSPVKPAGASGPSPRIEITPSHELMQAGGALRGRDAGLSPEQPALALAGVAASPRFTLPVPGYEGYREPLCLSPASSGSSASFISDTFSPYTSPCVSPNNAGPDDLCPQFQNIPAHYSPRTSPIMSPRTSLAEDSCLGRHSPVPRPASRSSSPGAKRRHSCAEALVAPLPAASPQRSRSPSPQPSPHVALQDDSIPAGYPPTAGSAVLMDALNTLATDSPCGIPSKIWKTSPDPTPVSTAPSKAGLARHIYPTVEFLGPCEQEERRNSAPESILLVPPTWPKQLVPAIPICSIPVTASLPPLEWPLSNQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHVPEPSGRIVSLQAASNPIECSQRSAHELPMVERQDMDSCLVYGGQQMILTGQNFTAESKVVFMEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRVPVKVNFYVINGKRKRSQPQHFTYHPVPAIKTEPSDEYEPSLICSPAHGGLGSQPYYPQHPMLAESPSCLVATMAPCQQFRSGLSSPDARYQQQSPAAALYQRSKSLSPGLLGYQQPSLLAAPLGLADAHRSVLVHAGSQGQGQGSTLPHTSSASQQASPVIHYSPTNQQLRGGGHQEFQHIMYCENFGPSSARPGPPPINQGQRLSPGAYPTVIQQQTAPSQRAAKNGPSDQKEALPTGVTVKQEQNLDQTYLDDVNEIIRKEFSGPPSRNQT il2_human_gene Human IL-2 gene IL2 gene gene human Homo sapiens Human ifng_human_gene Interferon gamma IFNG gene gene human Homo sapiens Human foxp3_human Forkhead box protein P3 Scurfin FOXP3 IPEX JM2 protein protein human Homo sapiens Human MPNPRPGKPSAPSLALGPSPGASPSWRAAPKASDLLGARGPGGTFQGRDLRGGAHASSSSLNPMPPSQLQLPTLPLVMVAPSGARLGPLPHLQALLQDRPHFMHQLSTVDAHARTPVLQVHPLESPAMISLTPPTTATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPNPSAPRKDSTLSAVPQSSYPLLANGVCKWPGCEKVFEEPEDFLKHCQADHLLDEKGRAQCLLQREMVQSLEQQLVLEKEKLSAMQAHLAGKMALTKASSVASSDKGSCCIVAAGSQGPVVPAWSGPREAPDSLFAVRRHLWGSHGNSTFPEFLHNMDYFKFHNMRPPFTYATLIRWAILEAPEKQRTLNEIYHWFTRMFAFFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDELEFRKKRSQRPSRCSNPTPGP runx1-il2-1 1859677 N/A 1859684 unspecified role unspecified role bait bait N/A 1859685 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 1B Q03347 increases the expression at protein level of ENSMUSG00000027720 The construct "AML1A" decreased the expression of IL2. Q99JB6 reduces the expression at protein level of ENSMUSG00000027720 foxp3-il2-8 1859677 N/A 1859686 unspecified role unspecified role bait bait N/A 1859685 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Supp 4 runx1-il2ra_mouse_gene-1 1859677 N/A 1859684 unspecified role unspecified role bait bait N/A 1859687 unspecified role unspecified role prey prey intron1_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Supp Fig 8 runx1-il2ra_mouse_gene-2 1859677 N/A 1859684 unspecified role unspecified role bait bait N/A 1859688 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Supp Fig 8-1 Q99JB6 increases the expression at protein level of ENSMUSG00000026011 runx1-ctla4-1 1859677 N/A 1859684 unspecified role unspecified role bait bait N/A 1859689 unspecified role unspecified role prey prey intronic_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Supp Fig 8-2 foxp3-tnfrsf18-1 1859677 N/A 1859686 unspecified role unspecified role bait bait N/A 1859689 unspecified role unspecified role prey prey intronic_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Supp Fig 9 Q99JB6 increases the expression at protein level of ENSMUSG00000041954 foxp3-il2ra_mouse_gene-3 1859677 N/A 1859686 unspecified role unspecified role bait bait N/A 1859687 unspecified role unspecified role prey prey intron1_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Supp Fig 9 Q99JB6 increases the expression at protein level of ENSMUSG00000026770 runx1-ifng-1 1859677 N/A 1859684 unspecified role unspecified role bait bait N/A 1859690 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Supp Fig 11D re1_probe_il2_promoter-runx1-1 1859678 N/A 1859691 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false c15t,a16g mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false N/A 1859692 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false DNA_binding_domain sufficient to bind sufficient binding region sufficient to bind range range range range false human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. direct interaction direct interaction false false false 1C re1_probe_il2_promoter-runx1-2 1859678 N/A 1859693 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false c16t,a17g mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false N/A 1859692 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false DNA_binding_domain sufficient to bind sufficient binding region sufficient to bind range range range range false human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. direct interaction direct interaction false false false 1C-2 re2_probe_il2_promoter-runx1-1 1859678 N/A 1859694 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false c17t,a18g mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false N/A 1859692 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false DNA_binding_domain sufficient to bind sufficient binding region sufficient to bind range range range range false human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. direct interaction direct interaction false false false 1C-3 Binding to the Re-2 probe was weaker. foxp3-runx1-5 1859679 N/A 1859684 unspecified role unspecified role bait bait region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1859686 unspecified role unspecified role prey prey n_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false physical association physical association false false false 2E, Supp 12 foxp3-runx1-6 1859679 N/A 1859684 unspecified role unspecified role prey prey n_terminus ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false N/A 1859686 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false Q99JB6:p.Asp329_Tyr330delinsValHis mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false Q99JB6:p.[Asp329_Tyr330delinsValHis;Lys332Leu] mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false 2G, 3G foxp3-nfatc2-2 1859679 N/A 1859686 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false N/A 1859695 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false undefined mutation mutation mutation undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false Supp 6 From Supp Ref 1 + 2,, HA-tagged NFAT-CA is a constitutive active form of murine NFAT1 isoform C with twelve serine to alanine mutations. This mutant is probably the (ST2+5+8) mutant described. runx1-il2-2 1859680 N/A 1859692 unspecified role unspecified role bait bait N/A 1859696 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 1B runx1-il2_human_gene-1 1859680 N/A 1859692 unspecified role unspecified role bait bait N/A 1859697 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Supp 11D foxp3-runx1-2 1859681 N/A 1859684 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro N/A 1859686 unspecified role unspecified role bait bait n_terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) physical association physical association false false false 2B runx1-foxp3-1 1859681 N/A 1859684 unspecified role unspecified role bait bait n_terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 1859686 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro physical association physical association false false false 2Bi foxp3-runx1-1 1859682 N/A 1859692 unspecified role unspecified role prey prey N/A 1859698 unspecified role unspecified role bait bait physical association physical association false false false 2A foxp3-runx1-3 1859683 N/A 1859684 unspecified role unspecified role neutral component neutral component N/A 1859686 unspecified role unspecified role neutral component neutral component colocalization colocalization false false false 2C